ID: 1134143632

View in Genome Browser
Species Human (GRCh38)
Location 16:11742848-11742870
Sequence CGTCAGCCGCGCCGCCGCCG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 160}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134143624_1134143632 13 Left 1134143624 16:11742812-11742834 CCGCAGCTCGCCGCACCCGCTAA 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1134143632 16:11742848-11742870 CGTCAGCCGCGCCGCCGCCGCGG 0: 1
1: 0
2: 3
3: 20
4: 160
1134143622_1134143632 19 Left 1134143622 16:11742806-11742828 CCAATCCCGCAGCTCGCCGCACC 0: 1
1: 0
2: 1
3: 6
4: 97
Right 1134143632 16:11742848-11742870 CGTCAGCCGCGCCGCCGCCGCGG 0: 1
1: 0
2: 3
3: 20
4: 160
1134143626_1134143632 3 Left 1134143626 16:11742822-11742844 CCGCACCCGCTAACCCGGACGCT 0: 1
1: 0
2: 0
3: 0
4: 64
Right 1134143632 16:11742848-11742870 CGTCAGCCGCGCCGCCGCCGCGG 0: 1
1: 0
2: 3
3: 20
4: 160
1134143623_1134143632 14 Left 1134143623 16:11742811-11742833 CCCGCAGCTCGCCGCACCCGCTA 0: 1
1: 0
2: 0
3: 6
4: 67
Right 1134143632 16:11742848-11742870 CGTCAGCCGCGCCGCCGCCGCGG 0: 1
1: 0
2: 3
3: 20
4: 160
1134143621_1134143632 20 Left 1134143621 16:11742805-11742827 CCCAATCCCGCAGCTCGCCGCAC 0: 1
1: 0
2: 1
3: 2
4: 35
Right 1134143632 16:11742848-11742870 CGTCAGCCGCGCCGCCGCCGCGG 0: 1
1: 0
2: 3
3: 20
4: 160
1134143628_1134143632 -3 Left 1134143628 16:11742828-11742850 CCGCTAACCCGGACGCTCCACGT 0: 1
1: 0
2: 0
3: 0
4: 19
Right 1134143632 16:11742848-11742870 CGTCAGCCGCGCCGCCGCCGCGG 0: 1
1: 0
2: 3
3: 20
4: 160
1134143627_1134143632 -2 Left 1134143627 16:11742827-11742849 CCCGCTAACCCGGACGCTCCACG 0: 1
1: 0
2: 0
3: 0
4: 33
Right 1134143632 16:11742848-11742870 CGTCAGCCGCGCCGCCGCCGCGG 0: 1
1: 0
2: 3
3: 20
4: 160
1134143620_1134143632 21 Left 1134143620 16:11742804-11742826 CCCCAATCCCGCAGCTCGCCGCA 0: 1
1: 0
2: 0
3: 2
4: 44
Right 1134143632 16:11742848-11742870 CGTCAGCCGCGCCGCCGCCGCGG 0: 1
1: 0
2: 3
3: 20
4: 160
1134143619_1134143632 29 Left 1134143619 16:11742796-11742818 CCGTTGCTCCCCAATCCCGCAGC 0: 1
1: 0
2: 1
3: 17
4: 237
Right 1134143632 16:11742848-11742870 CGTCAGCCGCGCCGCCGCCGCGG 0: 1
1: 0
2: 3
3: 20
4: 160
1134143629_1134143632 -10 Left 1134143629 16:11742835-11742857 CCCGGACGCTCCACGTCAGCCGC 0: 1
1: 0
2: 0
3: 3
4: 53
Right 1134143632 16:11742848-11742870 CGTCAGCCGCGCCGCCGCCGCGG 0: 1
1: 0
2: 3
3: 20
4: 160
1134143618_1134143632 30 Left 1134143618 16:11742795-11742817 CCCGTTGCTCCCCAATCCCGCAG 0: 1
1: 0
2: 0
3: 10
4: 141
Right 1134143632 16:11742848-11742870 CGTCAGCCGCGCCGCCGCCGCGG 0: 1
1: 0
2: 3
3: 20
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134143632 Original CRISPR CGTCAGCCGCGCCGCCGCCG CGG Exonic
900184691 1:1327577-1327599 CGTGCGCCGCGCCGTCACCGTGG + Exonic
900605076 1:3520233-3520255 AGTCAGCCAGGCCGCCTCCGGGG + Intronic
901433995 1:9235079-9235101 CGCCGGCCCCGCCGCCGCCCCGG + Intronic
902856522 1:19210198-19210220 CGGCAGCGGCTCCGGCGCCGGGG - Exonic
904037922 1:27568695-27568717 GGGCACCCGCGCCGCGGCCGGGG - Intronic
904641954 1:31937944-31937966 CGGCCCCCGCGCCGGCGCCGGGG - Intronic
904716446 1:32471254-32471276 TGTCAGCCGAGCCACCGCCAAGG - Exonic
905369197 1:37474393-37474415 CGTCCGGCGCGCAGCGGCCGCGG + Intergenic
905793496 1:40802554-40802576 CGTAAGCCCCGCCCTCGCCGAGG + Intronic
905912070 1:41662094-41662116 CGCGCGCCGCGCCCCCGCCGCGG - Intronic
906365378 1:45205873-45205895 CCCCAGCCGCGACGCCCCCGGGG + Exonic
906365420 1:45205969-45205991 CGCCAGCAGCGCCGGCGCCGGGG + Exonic
911633952 1:100213246-100213268 CGTGCGCCGCGTCCCCGCCGGGG + Intronic
914902361 1:151717488-151717510 CGCCCGCGGCGCCGCCTCCGCGG - Intronic
914937522 1:151993751-151993773 CGTCCGCCGCGCCTCGGCCAAGG - Exonic
918015957 1:180632460-180632482 CCGCAGCCCCGCTGCCGCCGGGG + Intronic
920260538 1:204685270-204685292 GGGCAGCGCCGCCGCCGCCGGGG - Intronic
922440659 1:225653059-225653081 CGCTCGCCGCGCCGCCGCCGAGG + Exonic
1063429633 10:5977464-5977486 CGGCAGCCGCGCGCCCGCCGCGG + Exonic
1063944678 10:11165284-11165306 TGAGAGCCTCGCCGCCGCCGAGG + Intronic
1066464491 10:35640748-35640770 AGGGAGCCGCGCCGCCGCCAGGG + Exonic
1067060823 10:43077144-43077166 CGTCCGCCGCGCCCCGGGCGGGG + Exonic
1069819273 10:71217544-71217566 CCTCAGCCGCTGCGCCCCCGCGG + Intronic
1071997722 10:91163507-91163529 CAGCAGCGGCGCCTCCGCCGAGG + Intronic
1075430409 10:122375150-122375172 CGTCGGCCCCGCGACCGCCGCGG - Intronic
1080779794 11:35419551-35419573 CATCACCCGCGCCGCCGCCTCGG + Intronic
1080802226 11:35619052-35619074 CTCCAGCCACGCCGCCGCCTGGG - Exonic
1082817000 11:57515536-57515558 CCTGAGCCGCGCCGGCGCTGGGG + Exonic
1083922315 11:65787507-65787529 CCGCAGCCTCGACGCCGCCGCGG - Intronic
1083927606 11:65818037-65818059 CGGGAGCCGCGCGGCCGGCGCGG - Intergenic
1085208146 11:74749312-74749334 CGGCAGCCGCGCCCCCGTCCCGG - Exonic
1091888073 12:4031259-4031281 CGCCCGCCGCGCCCCCGCCCGGG + Intergenic
1092743058 12:11649042-11649064 CGTCTGCGGCGCGGCCGCCCCGG + Intergenic
1094317664 12:29149987-29150009 CGTCAGCCACGACCCCGGCGAGG - Intronic
1097262294 12:57726566-57726588 CGTGGGCCGCGCCGACGCCCCGG - Exonic
1097264420 12:57737514-57737536 CGCCACCGCCGCCGCCGCCGGGG - Exonic
1100330017 12:93572986-93573008 CGCCAGACGCGCCGCCTGCGGGG - Exonic
1101466923 12:104958361-104958383 GCGCAGCCGCGCCGCCGCCGGGG + Intronic
1102136921 12:110583112-110583134 CCGCAGTCGCGCCGCCGCTGGGG + Exonic
1102913594 12:116737261-116737283 CTTCTGCAGCGGCGCCGCCGGGG - Intronic
1105943606 13:25171437-25171459 CGGCCGCCGAGCCGCCGTCGGGG - Exonic
1105943640 13:25171580-25171602 TGACAGCCCCGCCGCCGCCGCGG + Exonic
1107548961 13:41457728-41457750 GGGCAGCCCCGCGGCCGCCGCGG + Exonic
1108408132 13:50124705-50124727 CGCCCGCCGCGCCGCCGTGGCGG - Intronic
1113379059 13:109786480-109786502 CGGGGTCCGCGCCGCCGCCGGGG + Exonic
1115906691 14:38209476-38209498 CGTCCGCAGCGCCGGCCCCGGGG - Exonic
1122220976 14:100239065-100239087 GGGAAGCCCCGCCGCCGCCGCGG + Exonic
1122543301 14:102509497-102509519 CGTCCCCCGCGCCGCGCCCGCGG - Intronic
1122978555 14:105181077-105181099 CGTGGGCCGGGCCGCCGGCGGGG + Intronic
1128119232 15:65133547-65133569 CGCCAGCGCCGCCTCCGCCGCGG + Exonic
1128171514 15:65517589-65517611 TGTCACCGGCGCCGCCGCCGAGG - Intronic
1130224553 15:82046978-82047000 CGAGCGCCGCGCCGCCACCGCGG + Intergenic
1130352939 15:83107558-83107580 CCTCAGCCGCGCCCCCCGCGTGG - Exonic
1132055674 15:98648984-98649006 CCTCAGCGCCGCCGCCGCCGCGG - Exonic
1132079490 15:98852345-98852367 CCGCGCCCGCGCCGCCGCCGTGG + Intronic
1132365126 15:101251565-101251587 GGGCAGCGCCGCCGCCGCCGCGG + Exonic
1133311305 16:4848127-4848149 CGCTAGCTGCGCCGCCGCCCGGG + Intronic
1133464737 16:6018967-6018989 CGCCAGCGCCGCCGCCGCCGCGG - Intergenic
1134143632 16:11742848-11742870 CGTCAGCCGCGCCGCCGCCGCGG + Exonic
1136498814 16:30659609-30659631 CGGGAGCAGCGGCGCCGCCGAGG + Exonic
1136779106 16:32885962-32885984 GGTGAGCCGGGCAGCCGCCGCGG - Intergenic
1136891511 16:33975556-33975578 GGTGAGCCGGGCAGCCGCCGCGG + Intergenic
1137426397 16:48384883-48384905 CGGGGGCCGGGCCGCCGCCGAGG + Intronic
1139364826 16:66427039-66427061 CGGGAGCCGCGCCGCCGCCGAGG + Intergenic
1139534452 16:67562810-67562832 CGGCGCCAGCGCCGCCGCCGGGG + Intronic
1139954256 16:70685809-70685831 CGTGCGCCTAGCCGCCGCCGCGG - Exonic
1140098528 16:71895332-71895354 CGTCTGCCGTGCCCCCGCCGCGG + Intronic
1141838077 16:86555671-86555693 CGTCCGCAGCGCAGTCGCCGGGG - Intergenic
1203081521 16_KI270728v1_random:1148050-1148072 GGTGAGCCGGGCAGCCGCCGCGG - Intergenic
1144109999 17:12021459-12021481 CCTCGGCCCCGCCGCCGCAGTGG + Intronic
1144682765 17:17206306-17206328 CCACAGCCACGCCGCCGCAGCGG + Exonic
1144879634 17:18424670-18424692 CCTCAGCCTCTCCGCCGCCTTGG - Intergenic
1146355234 17:32127798-32127820 AGTCAGCCGGGCCGCCGAGGCGG + Intergenic
1147312937 17:39605810-39605832 CGTGCGCCGCGCCGCCGCCCAGG + Exonic
1148262236 17:46193547-46193569 CGCCCGCCGCGCCGCCCCCGCGG + Intronic
1148323248 17:46769971-46769993 CGTCACCCGCTCCTGCGCCGAGG - Exonic
1150003656 17:61456649-61456671 CGTCGTCGCCGCCGCCGCCGCGG + Exonic
1150283165 17:63940989-63941011 CGTCATCCCCGCTGCCGTCGTGG + Exonic
1151625100 17:75271325-75271347 CGGAAGCCGCGCCGCCTGCGTGG + Intergenic
1152555944 17:81053336-81053358 GCTCAGACGCGCCGCTGCCGAGG - Intronic
1153052191 18:909452-909474 CGTCCCCCGCGCCGCCGCCGAGG - Exonic
1153285156 18:3449999-3450021 CGTCCGCACCGCCGCCCCCGAGG + Intronic
1158893525 18:61894041-61894063 CGGCGGCCGCGCCGAAGCCGTGG - Intronic
1158954083 18:62523335-62523357 TGACGGCCGCGCCGCCGCCTCGG + Exonic
1160904802 19:1447048-1447070 CGTCTGCCGACTCGCCGCCGGGG + Intronic
1160921802 19:1524151-1524173 CGACTCCTGCGCCGCCGCCGCGG - Intronic
1163513076 19:17747711-17747733 CGGCAGCCGCGCCGCAGCCGCGG + Exonic
1165803137 19:38565194-38565216 CGTCGCCCCCGCCGCCGCCGTGG - Exonic
1165832388 19:38736150-38736172 AGTCAGCCTCGTCGCCGGCGTGG + Exonic
1166723620 19:45012071-45012093 CCCCAGCCACGCCGCCGCCTTGG + Exonic
1167679953 19:50912945-50912967 CCTCACCCGCGCCGGCTCCGCGG - Intergenic
1167792119 19:51689333-51689355 CGACGGCCGCGCAGCCGGCGGGG + Intergenic
1168336497 19:55600292-55600314 CCCCCGCCTCGCCGCCGCCGAGG + Intronic
1168346801 19:55653868-55653890 CGTCTGCCGCGCCTGCGCGGCGG + Intergenic
1168401234 19:56087263-56087285 CGTCAGCCGCGCCCCGGGAGTGG - Intergenic
927472265 2:23385393-23385415 CCCCAGCCCCGCGGCCGCCGCGG + Exonic
932621871 2:73269465-73269487 CGACGGCGCCGCCGCCGCCGCGG - Exonic
938338906 2:130522750-130522772 CGTCAGCCCCGCGCCCCCCGCGG - Intronic
938350932 2:130598000-130598022 CGTCAGCCCCGCGCCCCCCGCGG + Intronic
938795850 2:134718243-134718265 GGGCAGCCGGGCGGCCGCCGAGG + Intronic
942681290 2:178480406-178480428 CTTCAGCCCCGCCGCCGGGGAGG + Intergenic
945188920 2:207166553-207166575 CGTCAGCCTCAGGGCCGCCGCGG - Intronic
946921430 2:224585161-224585183 CGCCGCCCCCGCCGCCGCCGCGG - Exonic
1171346723 20:24470848-24470870 CGTCAGATGCGCTGGCGCCGCGG + Intronic
1172100891 20:32483564-32483586 CGGCAGCGGCGGCGGCGCCGCGG + Intronic
1172239267 20:33401406-33401428 GGTGAGCAGCGCGGCCGCCGGGG - Exonic
1175847000 20:62064788-62064810 CGGCTGCGGCGCCGGCGCCGGGG - Exonic
1175859488 20:62142867-62142889 CGTGGGTCGCGCCGCCGCCCCGG - Intronic
1176556251 21:8255724-8255746 CGGCGGCGGCGGCGCCGCCGCGG - Intergenic
1176566766 21:8392109-8392131 CCTGCGCCGCGCCGCCGGCGGGG + Intergenic
1176575190 21:8438766-8438788 CGGCGGCGGCGGCGCCGCCGCGG - Intergenic
1180871703 22:19150292-19150314 CGGCCGGGGCGCCGCCGCCGCGG + Intergenic
1181474670 22:23160898-23160920 CTTCAGCCGCGTAGCCGCCCTGG + Exonic
1183683769 22:39350209-39350231 CCGCCGCCGCGCCGCCGCCGGGG - Intronic
1184423413 22:44395143-44395165 CACCATCCGCGCCGCCGCCGTGG - Intergenic
1185397658 22:50600973-50600995 CCCCAGCCCCGCCGCCGGCGCGG + Intronic
1203253239 22_KI270733v1_random:127821-127843 CGGCGGCGGCGGCGCCGCCGCGG - Intergenic
1203261294 22_KI270733v1_random:172902-172924 CGGCGGCGGCGGCGCCGCCGCGG - Intergenic
950729770 3:14947544-14947566 CGCCAGCCTCGCCGCCGCGGCGG - Intergenic
959530731 3:107431535-107431557 GGTCACCGCCGCCGCCGCCGGGG + Intergenic
963253284 3:143120782-143120804 CCTCCGCCGCGCCGCCGGCCCGG + Exonic
963673481 3:148280654-148280676 CCTGAGCCTCGCCCCCGCCGTGG - Intergenic
964438183 3:156675290-156675312 CGTCTTCCTCCCCGCCGCCGCGG + Exonic
966866182 3:184260246-184260268 CGTCAGCCGCGCGGCCTCGGGGG + Intronic
968460483 4:722389-722411 CGCCAGCCACGCCGCTGCCTGGG - Intronic
977810019 4:101347297-101347319 CGGCCGCCTCTCCGCCGCCGGGG - Exonic
977885732 4:102250382-102250404 CTTCAGCCTCCCCGCAGCCGCGG - Intergenic
978072626 4:104491565-104491587 CAGCAGCGCCGCCGCCGCCGCGG - Exonic
981034211 4:140153129-140153151 CGGCCGCCGAACCGCCGCCGGGG + Exonic
986748019 5:10761092-10761114 CGAGAACCGCGCCGCCGCCTCGG - Exonic
988949378 5:36241799-36241821 CGTGGGCCGGGCCGCGGCCGCGG + Intronic
997990809 5:138543147-138543169 CGTCAGAGCCGCCGCCGCCGCGG - Exonic
1002462269 5:179380290-179380312 TGTCAGCCGAGTCGTCGCCGTGG + Intergenic
1003566765 6:7229221-7229243 CGTCAGGCCTGCCCCCGCCGAGG + Exonic
1007094008 6:39202351-39202373 TGTGAGCCCCGCCGCCGCTGGGG - Intronic
1008932519 6:56955085-56955107 CATCAGCCGAGCCCCCGCCGCGG - Intergenic
1010001775 6:70956246-70956268 CGTGAGCCGGGCCGCCCCTGCGG + Exonic
1011194005 6:84763992-84764014 TTTCGCCCGCGCCGCCGCCGCGG + Exonic
1019343058 7:517554-517576 CGCCAGGAGCGCCGCCGCCCCGG + Intronic
1019381651 7:727278-727300 CTGCAGCTGCGCCGCCGCCCTGG + Exonic
1019544977 7:1569883-1569905 CCTCGGCCTCGCCGCCGCCCCGG + Exonic
1021958800 7:25852584-25852606 CGTCCTCCGCGCCCCCGCCCCGG + Intergenic
1023758824 7:43444891-43444913 CCTCTGCCGCGCTGCCGCCCTGG - Exonic
1028621429 7:92833337-92833359 CGCCCGCCGCGGCGCCGCTGGGG + Exonic
1028987743 7:97021367-97021389 CACGAGGCGCGCCGCCGCCGAGG - Intronic
1029456913 7:100676135-100676157 CGTCAGGCCCGAGGCCGCCGGGG - Intronic
1033366134 7:140673540-140673562 CGCCAGCCGCCCCGCTGCAGCGG - Exonic
1034243154 7:149624767-149624789 CGTCGGCCGCGCCGGCTCCCAGG - Intergenic
1034977856 7:155458449-155458471 CGCCGCCCGAGCCGCCGCCGGGG - Exonic
1036195275 8:6708505-6708527 CATGGGCCGCGCCGCCGCCCGGG - Exonic
1036801394 8:11795036-11795058 CCTCCCCCGCGCCGCCGCCGTGG + Intergenic
1036910486 8:12754424-12754446 CGACAGCCAGGCCGCGGCCGAGG + Intronic
1041109403 8:54470521-54470543 CGTCAGCTGCCCCGGCGCGGCGG - Intergenic
1044343155 8:91070679-91070701 CCTACCCCGCGCCGCCGCCGGGG + Intronic
1048214033 8:132480099-132480121 CCCCAAGCGCGCCGCCGCCGAGG + Intronic
1049194520 8:141308115-141308137 CGGCCGCCCCGCCGCCCCCGCGG - Intronic
1049694407 8:143976473-143976495 GGTCAGCCGCGCCTCCCCAGCGG + Intronic
1049759727 8:144326561-144326583 CCGCAGGCCCGCCGCCGCCGTGG + Exonic
1050230921 9:3525589-3525611 CCGCTGCGGCGCCGCCGCCGAGG - Intronic
1050343323 9:4662507-4662529 CAGCAGCCGCGCCACGGCCGTGG + Exonic
1052358416 9:27529030-27529052 CGTCAGCCAGGTCGCCCCCGGGG - Intronic
1057623268 9:96655230-96655252 GGTTAGCGGCGCCGCCGCCCTGG - Exonic
1057810849 9:98255637-98255659 CGTCGGCCCCGCCCCCGCCCAGG - Intronic
1060209098 9:121699480-121699502 GGTCCCCCGCGCCGCCGCCCCGG + Intronic
1061196658 9:129110563-129110585 AGTCCGCGCCGCCGCCGCCGCGG + Exonic
1061583907 9:131554576-131554598 CGGCAGCCCCGCCACCCCCGAGG + Intergenic
1062305905 9:135907126-135907148 GAGCGGCCGCGCCGCCGCCGAGG - Exonic
1062421072 9:136483052-136483074 CGTCGGCGGCGCGGCGGCCGCGG - Intronic
1203469641 Un_GL000220v1:110968-110990 CGGCGGCGGCGGCGCCGCCGCGG - Intergenic
1203477462 Un_GL000220v1:154940-154962 CGGCGGCGGCGGCGCCGCCGCGG - Intergenic
1186496501 X:10015714-10015736 CTCCTTCCGCGCCGCCGCCGCGG + Exonic
1188811333 X:34657046-34657068 CGTCCGCCCCGCCGCAGGCGAGG + Exonic
1189534656 X:41923690-41923712 TGGAAGCCGCGCCGCCGACGGGG - Intergenic
1190345328 X:49332010-49332032 CGCCCGCCTCGCCCCCGCCGGGG - Intronic
1190346423 X:49341575-49341597 CGCCCGCCTCGCCCCCGCCGGGG - Intronic
1190347674 X:49532604-49532626 CGCCCGCCTCGCCCCCGCCGGGG - Intronic
1190348775 X:49542160-49542182 CGCCCGCCTCGCCCCCGCCGGGG - Intronic
1190349875 X:49551716-49551738 CGCCCGCCTCGCCCCCGCCGGGG - Intronic
1190350980 X:49561269-49561291 CGCCCGCCTCGCCCCCGCCGGGG - Intronic
1190352081 X:49570827-49570849 CGCCCGCCTCGCCCCCGCCGGGG - Intronic
1190353182 X:49580376-49580398 CGCCCGCCTCGCCCCCGCCGGGG - Intronic
1190354282 X:49589923-49589945 CGCCTGCCTCGCCCCCGCCGGGG - Intronic
1190355385 X:49599447-49599469 CGCCCGCCTCGCCCCCGCCGGGG - Intronic
1192925002 X:75747086-75747108 CGCCACCGCCGCCGCCGCCGCGG + Intergenic