ID: 1134143633

View in Genome Browser
Species Human (GRCh38)
Location 16:11742849-11742871
Sequence GTCAGCCGCGCCGCCGCCGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 201}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134143620_1134143633 22 Left 1134143620 16:11742804-11742826 CCCCAATCCCGCAGCTCGCCGCA 0: 1
1: 0
2: 0
3: 2
4: 44
Right 1134143633 16:11742849-11742871 GTCAGCCGCGCCGCCGCCGCGGG 0: 1
1: 0
2: 2
3: 31
4: 201
1134143623_1134143633 15 Left 1134143623 16:11742811-11742833 CCCGCAGCTCGCCGCACCCGCTA 0: 1
1: 0
2: 0
3: 6
4: 67
Right 1134143633 16:11742849-11742871 GTCAGCCGCGCCGCCGCCGCGGG 0: 1
1: 0
2: 2
3: 31
4: 201
1134143629_1134143633 -9 Left 1134143629 16:11742835-11742857 CCCGGACGCTCCACGTCAGCCGC 0: 1
1: 0
2: 0
3: 3
4: 53
Right 1134143633 16:11742849-11742871 GTCAGCCGCGCCGCCGCCGCGGG 0: 1
1: 0
2: 2
3: 31
4: 201
1134143622_1134143633 20 Left 1134143622 16:11742806-11742828 CCAATCCCGCAGCTCGCCGCACC 0: 1
1: 0
2: 1
3: 6
4: 97
Right 1134143633 16:11742849-11742871 GTCAGCCGCGCCGCCGCCGCGGG 0: 1
1: 0
2: 2
3: 31
4: 201
1134143621_1134143633 21 Left 1134143621 16:11742805-11742827 CCCAATCCCGCAGCTCGCCGCAC 0: 1
1: 0
2: 1
3: 2
4: 35
Right 1134143633 16:11742849-11742871 GTCAGCCGCGCCGCCGCCGCGGG 0: 1
1: 0
2: 2
3: 31
4: 201
1134143628_1134143633 -2 Left 1134143628 16:11742828-11742850 CCGCTAACCCGGACGCTCCACGT 0: 1
1: 0
2: 0
3: 0
4: 19
Right 1134143633 16:11742849-11742871 GTCAGCCGCGCCGCCGCCGCGGG 0: 1
1: 0
2: 2
3: 31
4: 201
1134143627_1134143633 -1 Left 1134143627 16:11742827-11742849 CCCGCTAACCCGGACGCTCCACG 0: 1
1: 0
2: 0
3: 0
4: 33
Right 1134143633 16:11742849-11742871 GTCAGCCGCGCCGCCGCCGCGGG 0: 1
1: 0
2: 2
3: 31
4: 201
1134143624_1134143633 14 Left 1134143624 16:11742812-11742834 CCGCAGCTCGCCGCACCCGCTAA 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1134143633 16:11742849-11742871 GTCAGCCGCGCCGCCGCCGCGGG 0: 1
1: 0
2: 2
3: 31
4: 201
1134143626_1134143633 4 Left 1134143626 16:11742822-11742844 CCGCACCCGCTAACCCGGACGCT 0: 1
1: 0
2: 0
3: 0
4: 64
Right 1134143633 16:11742849-11742871 GTCAGCCGCGCCGCCGCCGCGGG 0: 1
1: 0
2: 2
3: 31
4: 201
1134143630_1134143633 -10 Left 1134143630 16:11742836-11742858 CCGGACGCTCCACGTCAGCCGCG 0: 1
1: 0
2: 0
3: 3
4: 39
Right 1134143633 16:11742849-11742871 GTCAGCCGCGCCGCCGCCGCGGG 0: 1
1: 0
2: 2
3: 31
4: 201
1134143619_1134143633 30 Left 1134143619 16:11742796-11742818 CCGTTGCTCCCCAATCCCGCAGC 0: 1
1: 0
2: 1
3: 17
4: 237
Right 1134143633 16:11742849-11742871 GTCAGCCGCGCCGCCGCCGCGGG 0: 1
1: 0
2: 2
3: 31
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134143633 Original CRISPR GTCAGCCGCGCCGCCGCCGC GGG Exonic