ID: 1134143633

View in Genome Browser
Species Human (GRCh38)
Location 16:11742849-11742871
Sequence GTCAGCCGCGCCGCCGCCGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 201}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134143626_1134143633 4 Left 1134143626 16:11742822-11742844 CCGCACCCGCTAACCCGGACGCT 0: 1
1: 0
2: 0
3: 0
4: 64
Right 1134143633 16:11742849-11742871 GTCAGCCGCGCCGCCGCCGCGGG 0: 1
1: 0
2: 2
3: 31
4: 201
1134143620_1134143633 22 Left 1134143620 16:11742804-11742826 CCCCAATCCCGCAGCTCGCCGCA 0: 1
1: 0
2: 0
3: 2
4: 44
Right 1134143633 16:11742849-11742871 GTCAGCCGCGCCGCCGCCGCGGG 0: 1
1: 0
2: 2
3: 31
4: 201
1134143628_1134143633 -2 Left 1134143628 16:11742828-11742850 CCGCTAACCCGGACGCTCCACGT 0: 1
1: 0
2: 0
3: 0
4: 19
Right 1134143633 16:11742849-11742871 GTCAGCCGCGCCGCCGCCGCGGG 0: 1
1: 0
2: 2
3: 31
4: 201
1134143624_1134143633 14 Left 1134143624 16:11742812-11742834 CCGCAGCTCGCCGCACCCGCTAA 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1134143633 16:11742849-11742871 GTCAGCCGCGCCGCCGCCGCGGG 0: 1
1: 0
2: 2
3: 31
4: 201
1134143629_1134143633 -9 Left 1134143629 16:11742835-11742857 CCCGGACGCTCCACGTCAGCCGC 0: 1
1: 0
2: 0
3: 3
4: 53
Right 1134143633 16:11742849-11742871 GTCAGCCGCGCCGCCGCCGCGGG 0: 1
1: 0
2: 2
3: 31
4: 201
1134143623_1134143633 15 Left 1134143623 16:11742811-11742833 CCCGCAGCTCGCCGCACCCGCTA 0: 1
1: 0
2: 0
3: 6
4: 67
Right 1134143633 16:11742849-11742871 GTCAGCCGCGCCGCCGCCGCGGG 0: 1
1: 0
2: 2
3: 31
4: 201
1134143619_1134143633 30 Left 1134143619 16:11742796-11742818 CCGTTGCTCCCCAATCCCGCAGC 0: 1
1: 0
2: 1
3: 17
4: 237
Right 1134143633 16:11742849-11742871 GTCAGCCGCGCCGCCGCCGCGGG 0: 1
1: 0
2: 2
3: 31
4: 201
1134143621_1134143633 21 Left 1134143621 16:11742805-11742827 CCCAATCCCGCAGCTCGCCGCAC 0: 1
1: 0
2: 1
3: 2
4: 35
Right 1134143633 16:11742849-11742871 GTCAGCCGCGCCGCCGCCGCGGG 0: 1
1: 0
2: 2
3: 31
4: 201
1134143627_1134143633 -1 Left 1134143627 16:11742827-11742849 CCCGCTAACCCGGACGCTCCACG 0: 1
1: 0
2: 0
3: 0
4: 33
Right 1134143633 16:11742849-11742871 GTCAGCCGCGCCGCCGCCGCGGG 0: 1
1: 0
2: 2
3: 31
4: 201
1134143622_1134143633 20 Left 1134143622 16:11742806-11742828 CCAATCCCGCAGCTCGCCGCACC 0: 1
1: 0
2: 1
3: 6
4: 97
Right 1134143633 16:11742849-11742871 GTCAGCCGCGCCGCCGCCGCGGG 0: 1
1: 0
2: 2
3: 31
4: 201
1134143630_1134143633 -10 Left 1134143630 16:11742836-11742858 CCGGACGCTCCACGTCAGCCGCG 0: 1
1: 0
2: 0
3: 3
4: 39
Right 1134143633 16:11742849-11742871 GTCAGCCGCGCCGCCGCCGCGGG 0: 1
1: 0
2: 2
3: 31
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134143633 Original CRISPR GTCAGCCGCGCCGCCGCCGC GGG Exonic
900786927 1:4655223-4655245 GGCCGGCGCGCCGCCGCCGTTGG - Exonic
901066613 1:6497392-6497414 GGCCGCAGAGCCGCCGCCGCCGG + Intronic
901805496 1:11736170-11736192 GGCACCTGCGCCGCAGCCGCGGG - Exonic
902726233 1:18337982-18338004 CTCAGCCACGCCGCCTCCCCCGG - Intronic
904037921 1:27568694-27568716 GGCACCCGCGCCGCGGCCGGGGG - Intronic
905369198 1:37474394-37474416 GTCCGGCGCGCAGCGGCCGCGGG + Intergenic
905414327 1:37794188-37794210 TGCAGGCGCGGCGCCGCCGCCGG - Exonic
905626225 1:39491940-39491962 ATCAGCTCCGCCGCCGCCCCTGG - Exonic
906026987 1:42682473-42682495 AGCAGCCCCACCGCCGCCGCCGG + Exonic
907010628 1:50959889-50959911 GCCACCGCCGCCGCCGCCGCCGG + Exonic
913144495 1:115976443-115976465 GACAGCCCCGCCGCCCGCGCAGG + Intergenic
913205527 1:116534642-116534664 GTGGGCAGCGCCGCCGCGGCGGG - Intronic
919826482 1:201506970-201506992 GCCAGCCCCGCCGCAGCCCCGGG - Intronic
920260540 1:204685272-204685294 CTGGGCAGCGCCGCCGCCGCCGG - Intronic
920805777 1:209232053-209232075 GTCAGCTGGGCCGGCGCCGCCGG + Intergenic
921029719 1:211326802-211326824 CTCCGCTTCGCCGCCGCCGCCGG + Intronic
921207173 1:212858615-212858637 GACAGCCTCGCTGCCGCCTCGGG + Exonic
922471957 1:225882303-225882325 GCCAGACACGCCGCCGCCGCAGG - Exonic
924801535 1:247332058-247332080 GTCAGCCACGTCGCCGCGCCCGG + Intergenic
1063429634 10:5977465-5977487 GGCAGCCGCGCGCCCGCCGCGGG + Exonic
1066464492 10:35640749-35640771 GGGAGCCGCGCCGCCGCCAGGGG + Exonic
1067369779 10:45672598-45672620 CCCAGCCGCGCTGCCGCCGCCGG - Intronic
1067478093 10:46579237-46579259 CTCCGCCCCGCCGCCCCCGCTGG + Intronic
1067616647 10:47762550-47762572 CTCCGCCCCGCCGCCCCCGCTGG - Intergenic
1069486646 10:68827896-68827918 GGAAGCCGCGCGGCGGCCGCAGG - Exonic
1069486733 10:68828232-68828254 GGAAGCCGCGCGGCGGCCGCAGG - Intronic
1069819274 10:71217545-71217567 CTCAGCCGCTGCGCCCCCGCGGG + Intronic
1070140144 10:73732788-73732810 GGCAGCCGGGCCCCAGCCGCAGG - Intergenic
1075430408 10:122375149-122375171 GTCGGCCCCGCGACCGCCGCGGG - Intronic
1075521537 10:123146480-123146502 GTCGGCCGCGCAGCCGGGGCAGG - Intergenic
1075709096 10:124521246-124521268 GTCAGCCGGGCACCTGCCGCTGG + Intronic
1076774976 10:132690167-132690189 GTGAGCCGTGCAGCCGCTGCTGG - Intronic
1076849875 10:133087505-133087527 GTCAGCAGGGCAGCCGCAGCCGG - Intronic
1076895406 10:133308986-133309008 GGCAGCGGCTCCGCCGCCCCGGG - Exonic
1078168524 11:8911135-8911157 CCCAGCTGCGCCGGCGCCGCCGG + Exonic
1078659825 11:13277858-13277880 CTCACCGCCGCCGCCGCCGCGGG + Exonic
1078821915 11:14891652-14891674 GCCAGCCGCGCCGCCACTTCAGG - Intronic
1080779795 11:35419552-35419574 ATCACCCGCGCCGCCGCCTCGGG + Intronic
1083322066 11:61853994-61854016 GTCAGCCCCGCCGCCAGGGCTGG + Intronic
1083595549 11:63916967-63916989 GTCGCCGCCGCCGCCGCCGCCGG - Intergenic
1083922314 11:65787506-65787528 CGCAGCCTCGACGCCGCCGCGGG - Intronic
1089573155 11:119423145-119423167 TCCAGACGCGCCGCCGCCTCCGG + Exonic
1090978386 11:131695026-131695048 GGGAGGAGCGCCGCCGCCGCCGG + Intronic
1092159844 12:6310378-6310400 GTCACCCTCGCCGCCTCCCCCGG + Intergenic
1092743057 12:11649038-11649060 GGCGGCCGCGCCGCAGACGCTGG - Intergenic
1096021540 12:48329622-48329644 GTCAGCGGCAGCGACGCCGCCGG + Exonic
1096154315 12:49333313-49333335 GGCGGCCGGGCAGCCGCCGCAGG + Intronic
1097267565 12:57755076-57755098 GTCTCCGCCGCCGCCGCCGCCGG + Exonic
1097854909 12:64452155-64452177 CTCCGCCGCGCCACCGCCGGCGG - Exonic
1100423460 12:94460000-94460022 GTCACCCACGCCACCGACGCCGG + Intergenic
1102136861 12:110582933-110582955 GTCGCCGCCGCCGCCGCCGCCGG + Exonic
1106340281 13:28820390-28820412 TCCACCTGCGCCGCCGCCGCCGG + Exonic
1106956362 13:34942771-34942793 AGCAGCGGCGCTGCCGCCGCCGG - Exonic
1108603105 13:52011718-52011740 CTCTGCCGTGCCGGCGCCGCAGG + Intergenic
1110705970 13:78602240-78602262 GTCGTGGGCGCCGCCGCCGCCGG + Exonic
1113874464 13:113585346-113585368 GTCAGCCGGGCGGGCGCCGCCGG + Intronic
1114065055 14:19053467-19053489 GTCAGCCCCGCAGCTGCAGCAGG - Intergenic
1114097206 14:19346535-19346557 GTCAGCCCCGCAGCTGCAGCAGG + Intergenic
1115474513 14:33800463-33800485 GGCGGCCGCGCCGTCGGCGCCGG - Exonic
1117803096 14:59464934-59464956 GACAGCAGCGGCGCCGCCTCCGG + Exonic
1118030340 14:61812598-61812620 GCCAGCCCTGCGGCCGCCGCCGG - Intergenic
1118463936 14:66013860-66013882 AGCAGCCCCACCGCCGCCGCCGG - Intergenic
1119520097 14:75278868-75278890 GTTCGCTGCGCCGCGGCCGCCGG - Exonic
1120905695 14:89619184-89619206 GGGAGCCGCGCCGCCGACCCCGG - Intergenic
1121074972 14:91060397-91060419 GGCAGCAGCGGCGGCGCCGCGGG - Exonic
1122736760 14:103847764-103847786 GTCCGCCCCTCCCCCGCCGCCGG - Intergenic
1122940759 14:104980362-104980384 GTTAGCCGCGCTGCAGCCACCGG + Intergenic
1122978562 14:105181088-105181110 GTCCCCCGCGCCCCCGCCGGCGG - Intronic
1125516460 15:40323833-40323855 GCCAGCGCCGCCGCCGCCGCCGG - Intergenic
1128109615 15:65068128-65068150 GCCGGCCGCGCCCCCACCGCCGG + Intronic
1128119182 15:65133394-65133416 GCCTGAGGCGCCGCCGCCGCCGG - Exonic
1128119233 15:65133548-65133570 GCCAGCGCCGCCTCCGCCGCGGG + Exonic
1128992510 15:72272557-72272579 GCCTGCCGCTCCGCCCCCGCGGG - Exonic
1129447009 15:75625682-75625704 GTCGCACGCGCCGCCGCCACCGG + Exonic
1130224554 15:82046979-82047001 GAGCGCCGCGCCGCCACCGCGGG + Intergenic
1130348017 15:83066898-83066920 GGTCGCGGCGCCGCCGCCGCTGG - Exonic
1131085901 15:89575564-89575586 ATCGGCCGTGCCGCCGCCCCGGG - Exonic
1131263540 15:90902699-90902721 GACAGCCGCGCCGCCCGCCCCGG - Intronic
1132365092 15:101251471-101251493 GCCCGCCGGGCCGCCGCCGCAGG + Exonic
1132365127 15:101251566-101251588 GGCAGCGCCGCCGCCGCCGCGGG + Exonic
1132374609 15:101320723-101320745 AGCAGCCGAGCCGCCGCCTCTGG - Intronic
1134143633 16:11742849-11742871 GTCAGCCGCGCCGCCGCCGCGGG + Exonic
1134290840 16:12902024-12902046 CTCGGCCGCTCGGCCGCCGCTGG - Exonic
1135821972 16:25692705-25692727 GCCGCCCGCGCCGCCGCCGCTGG + Exonic
1136634100 16:31508285-31508307 GGCTGCCGCGCCGCCGCGGACGG - Exonic
1136779105 16:32885961-32885983 GTGAGCCGGGCAGCCGCCGCGGG - Intergenic
1136891512 16:33975557-33975579 GTGAGCCGGGCAGCCGCCGCGGG + Intergenic
1138065473 16:53936841-53936863 GTCAACGGAGCCGCCGCAGCTGG + Intronic
1138591167 16:58000479-58000501 GTAGGCCGCGCCGCCGCGGATGG - Intronic
1139364827 16:66427040-66427062 GGGAGCCGCGCCGCCGCCGAGGG + Intergenic
1140098529 16:71895333-71895355 GTCTGCCGTGCCCCCGCCGCGGG + Intronic
1140223752 16:73063150-73063172 GTCAGAGGCGCCGCCACCGGCGG + Intergenic
1140442519 16:74998929-74998951 GTCAGCGGCCCAGGCGCCGCAGG + Intronic
1141582727 16:85011329-85011351 GTCGCCGCCGCCGCCGCCGCAGG - Exonic
1141665320 16:85462765-85462787 GGCAGCCGCGCCGCCACGGCTGG + Intergenic
1142393259 16:89816374-89816396 GGCAGCCGCGCCGCCCCAGCCGG + Intronic
1203081520 16_KI270728v1_random:1148049-1148071 GTGAGCCGGGCAGCCGCCGCGGG - Intergenic
1142711160 17:1724802-1724824 GTCCGCCTCTTCGCCGCCGCCGG + Intronic
1142876306 17:2853679-2853701 CTCAGACGCGCCGCCCGCGCCGG - Intronic
1143524312 17:7463342-7463364 GTCAGCCCAGCCACCGCTGCAGG - Exonic
1145765507 17:27456258-27456280 GCCTGCCTCGCCGCGGCCGCCGG + Intergenic
1147150399 17:38510684-38510706 GCCAGCTGCTCCGGCGCCGCCGG - Exonic
1147653023 17:42072712-42072734 AGGAGCCGCGCCGCCCCCGCCGG + Intergenic
1147966938 17:44199077-44199099 GACAGCCGAGCCGCCGGGGCCGG + Intronic
1148262237 17:46193548-46193570 GCCCGCCGCGCCGCCCCCGCGGG + Intronic
1148556598 17:48582232-48582254 CTCCTCCGCGCCGCCGCCGCCGG - Intronic
1151155646 17:72121830-72121852 CCCTGCCGCGCCGCCCCCGCCGG - Intronic
1151612171 17:75183155-75183177 GCCAGGCGCGCCCCCGCGGCGGG - Intergenic
1152596214 17:81239009-81239031 GGCTGCCGCGCCGCCGCTACGGG - Exonic
1153805717 18:8706714-8706736 GTGAGCCGCGCCTCGGCCGCAGG + Intronic
1154173770 18:12068423-12068445 CTCCGCGCCGCCGCCGCCGCCGG + Intergenic
1154449147 18:14460381-14460403 GTCAGCCCCGCAGCTGCAGCAGG + Intergenic
1157496797 18:48162083-48162105 GCCAGACCCCCCGCCGCCGCAGG + Intronic
1159798108 18:72867793-72867815 CTGAGCCACCCCGCCGCCGCCGG - Exonic
1160453343 18:78979745-78979767 GCCCCCCCCGCCGCCGCCGCCGG - Intergenic
1160455247 18:78994806-78994828 GACAGCCCAGCCGCCGCCCCGGG + Exonic
1160784077 19:891718-891740 GTCAGCCCCGCCTCGGCCACAGG - Intronic
1161031899 19:2061449-2061471 CGCAGGCGCGCGGCCGCCGCCGG - Intergenic
1161412418 19:4123890-4123912 GCTAGAGGCGCCGCCGCCGCCGG - Exonic
1163743880 19:19033458-19033480 GCCACCCCCGCCGCCGCCTCAGG + Intronic
1164598622 19:29546644-29546666 GGCAGCCTCGCCGTCCCCGCTGG + Intronic
1164658576 19:29942479-29942501 GCCGGCCGCGCCGCCTGCGCAGG + Exonic
1165274283 19:34734397-34734419 CTGAGCCCCGCCGCCGCCCCCGG - Intronic
1165293067 19:34904869-34904891 GGCAGCCCCGCCGCTGCAGCCGG - Intergenic
1165832389 19:38736151-38736173 GTCAGCCTCGTCGCCGGCGTGGG + Exonic
1166092548 19:40519654-40519676 TGCAGCCGCGCCGCCTGCGCCGG - Exonic
1168346802 19:55653869-55653891 GTCTGCCGCGCCTGCGCGGCGGG + Intergenic
929760531 2:44802651-44802673 GTACGCCGCGGCGCCGCAGCAGG - Intergenic
934783195 2:96986121-96986143 GTCAGCCCCGGTGCGGCCGCCGG - Intronic
936433287 2:112482302-112482324 GGCCGCCGGGCAGCCGCCGCAGG - Exonic
938058234 2:128233013-128233035 GTCACCCGCGCGACCACCGCGGG + Intergenic
938397858 2:130963978-130964000 GGCCGCCGCACCGCCGCCCCCGG + Intronic
938482307 2:131672470-131672492 GTCAGCCCCGCAGCTGCAGCAGG - Intergenic
938795851 2:134718244-134718266 GGCAGCCGGGCGGCCGCCGAGGG + Intronic
942170271 2:173282851-173282873 GTCGGCCGCGCTGCCGGCCCCGG - Intergenic
942461672 2:176172412-176172434 GTCGCCTGCGCCTCCGCCGCTGG - Exonic
943639559 2:190343696-190343718 CTCAGCCAGGCCGCCGCCCCCGG - Exonic
943906126 2:193502671-193502693 GCCAGCCGGCCCGCCGCCACGGG - Intergenic
946908974 2:224442327-224442349 CTCGGCCGCGCCGCCGGCCCGGG - Intergenic
947119407 2:226799803-226799825 GGCAGCCGGGCAGCCGCCGCCGG + Intergenic
947418480 2:229921700-229921722 TTCCGCGGCCCCGCCGCCGCCGG + Intronic
1168753081 20:297591-297613 TTCCTCCGCGCCGCCGCCGGTGG - Exonic
1170756810 20:19212495-19212517 CCCCGCCGCGCCGCCGCCCCAGG + Intergenic
1171499830 20:25585172-25585194 GGCGCCCGCGCCGCCGCCGTCGG + Intronic
1172771427 20:37384576-37384598 AGCGTCCGCGCCGCCGCCGCTGG + Intronic
1173820158 20:46014275-46014297 GTGAGCGCCGCCGCGGCCGCCGG + Intronic
1176447058 21:6830121-6830143 GTCAGCCCCGCAGCTGCAGCAGG - Intergenic
1176556250 21:8255723-8255745 GGCGGCGGCGGCGCCGCCGCGGG - Intergenic
1176575189 21:8438765-8438787 GGCGGCGGCGGCGCCGCCGCGGG - Intergenic
1176825229 21:13695147-13695169 GTCAGCCCCGCAGCTGCAGCAGG - Intergenic
1180483545 22:15776087-15776109 GTCAGCCCCGCAGCTGCAGCAGG - Intergenic
1180871704 22:19150293-19150315 GGCCGGGGCGCCGCCGCCGCGGG + Intergenic
1182451910 22:30426758-30426780 CTCAGCCACACCACCGCCGCTGG - Exonic
1183328502 22:37207047-37207069 GTTCGGAGCGCCGCCGCCGCTGG + Exonic
1183683768 22:39350208-39350230 CGCCGCCGCGCCGCCGCCGGGGG - Intronic
1183683773 22:39350211-39350233 GCCCGCCGCCGCGCCGCCGCCGG - Intronic
1184423412 22:44395142-44395164 ACCATCCGCGCCGCCGCCGTGGG - Intergenic
1185055361 22:48576115-48576137 ATCAGCCCCGCCGCCGCCCCCGG - Intronic
1203253238 22_KI270733v1_random:127820-127842 GGCGGCGGCGGCGCCGCCGCGGG - Intergenic
1203261293 22_KI270733v1_random:172901-172923 GGCGGCGGCGGCGCCGCCGCGGG - Intergenic
950729769 3:14947543-14947565 GCCAGCCTCGCCGCCGCGGCGGG - Intergenic
953947574 3:47163352-47163374 GTCCGAGGCGCCGCCGTCGCGGG + Intronic
963904452 3:150762655-150762677 GCCGGCCCCGCCGCCGCCGCCGG + Exonic
964201452 3:154122397-154122419 GCCTGCGCCGCCGCCGCCGCCGG + Exonic
964438184 3:156675291-156675313 GTCTTCCTCCCCGCCGCCGCGGG + Exonic
965404133 3:168249541-168249563 GACAGCCCCGCCGCCACCACGGG - Intergenic
965551274 3:169967112-169967134 CACAGCCGCGCCTCCGCAGCCGG - Intronic
966592241 3:181695879-181695901 GTCGGCCCCGCCGCGGCCCCAGG + Intergenic
966866183 3:184260247-184260269 GTCAGCCGCGCGGCCTCGGGGGG + Intronic
966915824 3:184583710-184583732 CCCAGCCGCGCCGCCGCAGCCGG + Intronic
967493780 3:190120993-190121015 GGCAGCCCCGCCGCTGCAGCGGG - Intronic
968148373 3:196318380-196318402 ATCAGCCGCGCCGCAGTCGGAGG + Intronic
968213366 3:196867892-196867914 GGCTGCCGCGACGCCGGCGCTGG - Exonic
969357751 4:6640545-6640567 TGCGGCCGCGACGCCGCCGCCGG + Exonic
970824153 4:20252968-20252990 GGCAGTCGGGCCGCCGCAGCCGG - Intergenic
971195691 4:24470717-24470739 GACCGTCGGGCCGCCGCCGCGGG - Intergenic
972586044 4:40437880-40437902 CTCAGCCGCGCCGCCGCCCCTGG + Exonic
975166717 4:71186591-71186613 TCGAGCCGCGCCGCCTCCGCCGG - Intergenic
977885731 4:102250381-102250403 TTCAGCCTCCCCGCAGCCGCGGG - Intergenic
982403298 4:154992460-154992482 GTAAGCCACGGCGCCCCCGCAGG + Intergenic
983940266 4:173529488-173529510 CTCAGCAGCGCTGCGGCCGCCGG + Exonic
985068419 4:186144913-186144935 GCCAGCCGCGCGGCGGGCGCGGG + Exonic
987193242 5:15500354-15500376 GCTCACCGCGCCGCCGCCGCCGG - Exonic
988949379 5:36241800-36241822 GTGGGCCGGGCCGCGGCCGCGGG + Intronic
990955105 5:61332658-61332680 GCCGCCCGCGGCGCCGCCGCCGG - Exonic
994107203 5:95961308-95961330 GTCGGCTGCGCTGCCGCTGCGGG - Intronic
997470581 5:134114923-134114945 GCCGCCCGCGCCGCCCCCGCCGG - Exonic
998583615 5:143404195-143404217 GTGGCCCGCGCCGCCGCCGCCGG + Intronic
1002462270 5:179380291-179380313 GTCAGCCGAGTCGTCGCCGTGGG + Intergenic
1003869403 6:10390300-10390322 GCCAGCCTCCCCGCCCCCGCCGG + Intergenic
1006599099 6:35214103-35214125 AGCAGCCCCGCCGCCGCCGCTGG + Intergenic
1007784203 6:44270780-44270802 GCCACCGCCGCCGCCGCCGCCGG - Exonic
1011983964 6:93419141-93419163 GCCGGCCGCGCCTCCGGCGCCGG - Intronic
1016010657 6:139135155-139135177 CGCAGCCGCGCGGGCGCCGCGGG - Exonic
1016923474 6:149317889-149317911 GCCAGCGCCGCCGCCGCCTCCGG - Intronic
1019112009 6:169724211-169724233 GTGAGAAGCGCCGCCGCCGCTGG - Intronic
1019343059 7:517555-517577 GCCAGGAGCGCCGCCGCCCCGGG + Intronic
1019577904 7:1746369-1746391 GTCCGTCGCGGAGCCGCCGCTGG + Exonic
1021845285 7:24757420-24757442 GGCAGCCGCGCCCCCTGCGCTGG + Intronic
1022427949 7:30285539-30285561 GGCCGCCGCGGCGCCGCCGGAGG - Exonic
1025608193 7:63054399-63054421 GTCCGCCGCGGCGCAGCCGCCGG + Intergenic
1028621485 7:92833563-92833585 GTCGCCGCCGCCGCCGCCGCCGG + Exonic
1028762337 7:94509914-94509936 GTCGGGGGCGCCGCGGCCGCGGG + Exonic
1036801395 8:11795037-11795059 CTCCCCCGCGCCGCCGCCGTGGG + Intergenic
1039543040 8:38386967-38386989 ATCAGGCGCGCCGAAGCCGCCGG + Intronic
1044988587 8:97775922-97775944 GCCCGCCGCGCCGCTGCTGCCGG - Exonic
1050744138 9:8857721-8857743 CACGGCCGCGCCGCCGCCTCCGG + Intronic
1053181287 9:35972389-35972411 GGCAGCCCCACCTCCGCCGCCGG - Intergenic
1055530355 9:77177575-77177597 TTCAGCTGCGGCGCCCCCGCTGG - Exonic
1056126231 9:83538383-83538405 GCCCGCCGCGCCCCGGCCGCTGG - Exonic
1058053329 9:100427372-100427394 GGCTGCCGCGCCGCCGCTGCAGG + Intronic
1060209099 9:121699481-121699503 GTCCCCCGCGCCGCCGCCCCGGG + Intronic
1060480422 9:124013897-124013919 GCCAGCGGCCCCTCCGCCGCCGG - Intronic
1060555277 9:124504736-124504758 CTCGGCCGCGCCGCCGCCGCCGG + Intronic
1062305904 9:135907125-135907147 AGCGGCCGCGCCGCCGCCGAGGG - Exonic
1062575606 9:137205861-137205883 GGCAGCCAAGCCGCCGGCGCCGG - Exonic
1203768391 EBV:38331-38353 GGCAGCCGGGCGGCCGCCGGTGG + Intergenic
1203768441 EBV:38456-38478 GGCAGCCGGGCGGCCGCCGGTGG + Intergenic
1203768491 EBV:38581-38603 GGCAGCCGGGCGGCCGCCGGTGG + Intergenic
1203768541 EBV:38706-38728 GGCAGCCGGGCGGCCGCCGGTGG + Intergenic
1203768591 EBV:38831-38853 GGCAGCCGGGCGGCCGCCGGTGG + Intergenic
1203768641 EBV:38956-38978 GGCAGCCGGGCGGCCGCCGGTGG + Intergenic
1203768691 EBV:39081-39103 GGCAGCCGGGCGGCCGCCGGTGG + Intergenic
1203768741 EBV:39206-39228 GGCAGCCGGGCGGCCGCCGGTGG + Intergenic
1203768791 EBV:39331-39353 GGCAGCCGGGCGGCCGCCGGTGG + Intergenic
1203768841 EBV:39456-39478 GGCAGCCGGGCGGCCGCCGGTGG + Intergenic
1203768891 EBV:39581-39603 GGCAGCCGGGCGGCCGCCGGTGG + Intergenic
1203768941 EBV:39706-39728 GGCAGCCGGGCGGCCGCCGGTGG + Intergenic
1203522132 Un_GL000213v1:54410-54432 GTCAGCCCCGCAGCTGCAGCAGG + Intergenic
1203469640 Un_GL000220v1:110967-110989 GGCGGCGGCGGCGCCGCCGCGGG - Intergenic
1203477461 Un_GL000220v1:154939-154961 GGCGGCGGCGGCGCCGCCGCGGG - Intergenic
1186496502 X:10015715-10015737 TCCTTCCGCGCCGCCGCCGCGGG + Exonic
1189534655 X:41923689-41923711 GGAAGCCGCGCCGCCGACGGGGG - Intergenic
1190385599 X:49879883-49879905 GTGCGCCGCGCCGCCGACCCCGG + Intergenic
1200100683 X:153688087-153688109 GCCAGCCGGGCAGCCTCCGCGGG + Exonic