ID: 1134148032

View in Genome Browser
Species Human (GRCh38)
Location 16:11783342-11783364
Sequence CGGTGAACGTTGATTAGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134148032_1134148035 -2 Left 1134148032 16:11783342-11783364 CCTCCACTAATCAACGTTCACCG No data
Right 1134148035 16:11783363-11783385 CGAGCAGTTCCCCAAGTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134148032 Original CRISPR CGGTGAACGTTGATTAGTGG AGG (reversed) Intronic
No off target data available for this crispr