ID: 1134148035

View in Genome Browser
Species Human (GRCh38)
Location 16:11783363-11783385
Sequence CGAGCAGTTCCCCAAGTTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134148031_1134148035 1 Left 1134148031 16:11783339-11783361 CCACCTCCACTAATCAACGTTCA No data
Right 1134148035 16:11783363-11783385 CGAGCAGTTCCCCAAGTTCAAGG No data
1134148033_1134148035 -5 Left 1134148033 16:11783345-11783367 CCACTAATCAACGTTCACCGAGC No data
Right 1134148035 16:11783363-11783385 CGAGCAGTTCCCCAAGTTCAAGG No data
1134148032_1134148035 -2 Left 1134148032 16:11783342-11783364 CCTCCACTAATCAACGTTCACCG No data
Right 1134148035 16:11783363-11783385 CGAGCAGTTCCCCAAGTTCAAGG No data
1134148029_1134148035 3 Left 1134148029 16:11783337-11783359 CCCCACCTCCACTAATCAACGTT No data
Right 1134148035 16:11783363-11783385 CGAGCAGTTCCCCAAGTTCAAGG No data
1134148030_1134148035 2 Left 1134148030 16:11783338-11783360 CCCACCTCCACTAATCAACGTTC No data
Right 1134148035 16:11783363-11783385 CGAGCAGTTCCCCAAGTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134148035 Original CRISPR CGAGCAGTTCCCCAAGTTCA AGG Intronic
No off target data available for this crispr