ID: 1134163214

View in Genome Browser
Species Human (GRCh38)
Location 16:11909207-11909229
Sequence CTTTGAAAGTAGAATTATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134163213_1134163214 -2 Left 1134163213 16:11909186-11909208 CCTTATTAAGTGTTCTTCTCTCT No data
Right 1134163214 16:11909207-11909229 CTTTGAAAGTAGAATTATGATGG No data
1134163210_1134163214 26 Left 1134163210 16:11909158-11909180 CCACTGTTAGGTCAGGTGCTCGG No data
Right 1134163214 16:11909207-11909229 CTTTGAAAGTAGAATTATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134163214 Original CRISPR CTTTGAAAGTAGAATTATGA TGG Intronic
No off target data available for this crispr