ID: 1134163890

View in Genome Browser
Species Human (GRCh38)
Location 16:11915327-11915349
Sequence GAGGAAGTCCGGCCGGGCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 119}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134163890_1134163899 4 Left 1134163890 16:11915327-11915349 CCGGCGCCCGGCCGGACTTCCTC 0: 1
1: 0
2: 2
3: 10
4: 119
Right 1134163899 16:11915354-11915376 GTCCCGGGCCTTTACCCGCACGG 0: 1
1: 0
2: 0
3: 7
4: 97
1134163890_1134163905 23 Left 1134163890 16:11915327-11915349 CCGGCGCCCGGCCGGACTTCCTC 0: 1
1: 0
2: 2
3: 10
4: 119
Right 1134163905 16:11915373-11915395 ACGGCCTCCCGCGCCGCTGCCGG 0: 1
1: 0
2: 0
3: 4
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134163890 Original CRISPR GAGGAAGTCCGGCCGGGCGC CGG (reversed) Intronic
900314570 1:2050472-2050494 GCGGAACTCCGGCGGCGCGCGGG - Exonic
901702868 1:11054774-11054796 CAGGAGGTCCGGCCCGGGGCTGG + Exonic
902385489 1:16073396-16073418 GAGGGGGCCCGGCCGGGGGCGGG - Intronic
903762903 1:25711692-25711714 GAGGAAGTGGGGCCCGGGGCAGG - Intronic
904720020 1:32500711-32500733 GAGGCCGGCCGGCCGGGCGCGGG - Intronic
905630332 1:39514851-39514873 GAGGGAGTGCGTCAGGGCGCGGG + Intronic
905667428 1:39771338-39771360 GAGGGAGTGCGTCAGGGCGCGGG - Exonic
905893919 1:41533253-41533275 GAGGTAGACCTGCCGGGCTCTGG + Intronic
906169023 1:43707919-43707941 GGGAAAGGCCGGCCGGACGCAGG + Intronic
906204524 1:43979699-43979721 GAGGGAGGCCGGCTGGACGCGGG - Intronic
913971511 1:143421195-143421217 CATGGAGTGCGGCCGGGCGCGGG + Intergenic
914065888 1:144246808-144246830 CATGGAGTGCGGCCGGGCGCGGG + Intergenic
914113263 1:144719546-144719568 CATGGAGTGCGGCCGGGCGCGGG - Intergenic
920705062 1:208244489-208244511 GAGGAAGTCCGCGCGGGCGGGGG - Intergenic
923093018 1:230753822-230753844 GAGGAAGCCGGGCCGGTCTCGGG - Intronic
1063638204 10:7805456-7805478 CAGGAAACCTGGCCGGGCGCAGG + Intronic
1064231039 10:13529202-13529224 CAGGCAGGCCGGCCGGGCCCGGG - Intergenic
1065974142 10:30827967-30827989 GAGGAAGCCAGGCTGAGCGCTGG + Intronic
1067052002 10:43026926-43026948 GAGGAAAGCCAGCTGGGCGCGGG + Intergenic
1067406658 10:46030165-46030187 GGGGAAGGCCGGCGGGGAGCAGG + Intronic
1069386028 10:67884455-67884477 GAGGAAGGGCCGCCGGCCGCCGG + Intergenic
1071309385 10:84328586-84328608 GGCGGAGTCCGGGCGGGCGCCGG + Exonic
1075390991 10:122091721-122091743 GAGGAAGTCCTGCCAGGCCAGGG + Intronic
1076818874 10:132928254-132928276 GAGGAAGTGGGGCCGGACCCAGG + Intronic
1076875395 10:133213298-133213320 GAGGAAGTTGGGCAGGGCCCTGG - Intronic
1077049544 11:560647-560669 GAGGAAGTCGGCCCAGGAGCGGG + Intronic
1077270901 11:1679962-1679984 GAGGAAGTGGAGCCGGGCCCTGG + Intergenic
1077308366 11:1877832-1877854 CATGGAGTGCGGCCGGGCGCAGG - Intronic
1077413131 11:2412746-2412768 GAGGAAATCCGGCAGGTCGGTGG - Exonic
1077433436 11:2527023-2527045 GAGGAAGGCCGGGCGGGCCCTGG + Intronic
1077923134 11:6655941-6655963 GAGGGAGGCCGGGCGGGCGCCGG - Intergenic
1079251683 11:18791848-18791870 GCGGAAGCCCGCCCGGGGGCGGG - Intronic
1082001183 11:47394521-47394543 GAGGAAGGCGGGCCTGGAGCGGG + Intergenic
1083332970 11:61907545-61907567 GAGGTACACCGGCTGGGCGCGGG - Exonic
1084563790 11:69918522-69918544 GAGGACGTCTGCCCGGGCTCCGG + Intergenic
1085205853 11:74731474-74731496 CAGGCAGCCCGGCCTGGCGCTGG + Intergenic
1088673521 11:112167544-112167566 GAGGAAGTGCGGAGGGGCGGCGG + Intronic
1088764458 11:112962385-112962407 GAGGAAGTGCGGAGGGGCGGAGG + Intronic
1090794574 11:130123778-130123800 GAGTAAGTCCTGCCTCGCGCTGG + Exonic
1091390942 12:125754-125776 GAGGAGGAGCGGCCGGGGGCAGG + Exonic
1092843031 12:12561832-12561854 GGGGGCGTGCGGCCGGGCGCGGG - Intronic
1098426101 12:70366663-70366685 GAGGCAGTCGGGCTCGGCGCCGG + Exonic
1100632227 12:96400310-96400332 GAGACTGTCTGGCCGGGCGCTGG + Exonic
1104585420 12:130044660-130044682 GTGGAGGTCCGGGCGGGTGCTGG + Intergenic
1105817598 13:24051290-24051312 CAGGAAGTCCTGCCGGCTGCAGG - Intronic
1133972929 16:10580243-10580265 GTGTAAGTCCGGCGGGGCGAGGG + Intronic
1134163890 16:11915327-11915349 GAGGAAGTCCGGCCGGGCGCCGG - Intronic
1139387926 16:66586158-66586180 TAGGAAGTCAGGCCGAGGGCAGG + Intronic
1141468487 16:84222576-84222598 GAAGGAGTCCGGGCGGGTGCTGG - Exonic
1142044209 16:87914696-87914718 GAGGACGTGGGGGCGGGCGCAGG + Intronic
1142129164 16:88424946-88424968 GAGGAAGGCCGGGCGGGTGGGGG - Intergenic
1142191582 16:88720639-88720661 GAGTAAGGGCGGCCGGGCGGCGG - Exonic
1142193405 16:88728248-88728270 CAGGAAGTGTGGCCGGGGGCCGG - Intronic
1144729291 17:17517513-17517535 GAGCAGGTCCGGCCAGGCACTGG + Intronic
1146283353 17:31559197-31559219 GAGGCGGTGCGGGCGGGCGCTGG + Intergenic
1148507147 17:48136458-48136480 GAGAAGGTCAGGCCGGGCGCAGG - Intronic
1150217116 17:63476991-63477013 GAGGAAGCGCGGCGGGGCGGGGG + Intergenic
1152357271 17:79813331-79813353 GGGGACGCTCGGCCGGGCGCAGG - Intergenic
1152627188 17:81393234-81393256 GAGGACGGCCGGCCCGGCTCCGG - Intergenic
1152663383 17:81553175-81553197 GAGGGAGGCGGGCCGGGGGCGGG - Intronic
1156249975 18:35343863-35343885 GAGGACGTCGGGCCGGGGCCGGG - Intronic
1159051213 18:63422617-63422639 GCGGAAGTCGGGCTCGGCGCAGG + Intergenic
1160391739 18:78539252-78539274 CAGGCAGTCATGCCGGGCGCCGG - Intergenic
1160539042 18:79610506-79610528 GAGGAAGGACGGCCAGGCCCGGG - Intergenic
1161143616 19:2664104-2664126 GAGGAAGTGCAGCCGGGCCTGGG - Intronic
1161270306 19:3385994-3386016 GAGGAGGATGGGCCGGGCGCAGG - Intronic
1161683581 19:5692451-5692473 TAGGAAGTCTGGCCGTGCGGTGG + Intronic
1161777572 19:6271987-6272009 GAGGGAAGCCGGCCAGGCGCCGG - Intronic
1161829340 19:6591151-6591173 GGGGATGTCCGGCCGGTCGAGGG + Exonic
1161899168 19:7105025-7105047 GAGGAACTCTGGCTGGGCTCTGG - Intergenic
1164825421 19:31281778-31281800 GAGGAAGTCTGTCGGGGGGCAGG - Intronic
1166103955 19:40588582-40588604 CAGGAAGTCAGGCCTGGTGCAGG - Intronic
1166852412 19:45767003-45767025 GAGGAAGCCGGGCAAGGCGCGGG + Exonic
1168247292 19:55118850-55118872 CAGGAGGTCCGGGTGGGCGCAGG - Intergenic
925065007 2:922616-922638 GAGGAACTTCGGCCGGGAGAAGG + Intergenic
925128295 2:1477092-1477114 GAGGAGGCCCGGCCGGCCGCGGG + Exonic
932715280 2:74096475-74096497 AAGCAGGTCAGGCCGGGCGCAGG + Intronic
934649594 2:96083395-96083417 GGGGAAGTCAGGCCTGGCGCCGG + Intergenic
937221738 2:120346056-120346078 GCGGAGGCCCGGGCGGGCGCGGG + Intergenic
938386252 2:130869373-130869395 GAGGAAGTCTCGCAGGGCTCCGG + Intronic
942277260 2:174332485-174332507 GAGGAAGGCGAGCAGGGCGCCGG + Intergenic
948806589 2:240455835-240455857 GCGGAGCTCCGGCCCGGCGCAGG - Intronic
1172126580 20:32628137-32628159 GAGGAAGTGTGGTCTGGCGCTGG + Intergenic
1172474468 20:35226703-35226725 AAGGCAGGCGGGCCGGGCGCGGG + Exonic
1176123319 20:63463981-63464003 CAGGAAGTCCGGCGGGGAGTGGG - Intronic
1176187788 20:63790844-63790866 GAGGACGCCGGGCGGGGCGCAGG + Exonic
1180044785 21:45300254-45300276 GAGGAAGGTGGGCCGGGCACAGG + Intergenic
1181762456 22:25067621-25067643 GAGGATGGCAGGCCAGGCGCAGG - Intronic
1182330507 22:29548262-29548284 GAGGAATTCCAGCTGGGTGCGGG + Intronic
1183381523 22:37492657-37492679 TTGGAAGTCCAGCCGGGAGCTGG + Exonic
1185208609 22:49554257-49554279 GAGGAAGCCAGGCCTGGCACAGG + Intronic
950208278 3:11096734-11096756 GAGAAAGTCTGAGCGGGCGCTGG + Intergenic
950583459 3:13878102-13878124 GAGGGAGTCCTGCAGGGCGCTGG - Intronic
952367122 3:32685078-32685100 GAGTACGTCCGGCCGGAGGCGGG + Intergenic
957014180 3:75043953-75043975 GAGGAAGACCTGCCGGGCTGGGG - Intergenic
962770918 3:138609230-138609252 GTGGAGGTGCGGCGGGGCGCGGG + Intronic
977257725 4:94758514-94758536 GAGGGAGCCCGGCGGGGCGGGGG + Intronic
988264458 5:28929638-28929660 GAGGATGGGCGGCCGGGCACAGG + Intergenic
995347763 5:111140230-111140252 GAGGAAGTCAGGCCAGGCGCAGG + Intergenic
999769153 5:154761950-154761972 GAAAAAGTCCTGCTGGGCGCGGG + Intronic
1002608422 5:180397610-180397632 AAGGAAATTCGGCCTGGCGCGGG - Intergenic
1002922254 6:1581015-1581037 GAGGGAGTCAGGCCTGGGGCGGG + Intergenic
1006606298 6:35259881-35259903 GCGGGAGGCCGGGCGGGCGCAGG + Intronic
1007557785 6:42781896-42781918 CATGAAGGCCGGGCGGGCGCGGG + Intronic
1014383097 6:120768489-120768511 GGGGAAGCCAGGCCGGGCGCGGG - Intergenic
1016590194 6:145735436-145735458 CAGCAGCTCCGGCCGGGCGCCGG + Exonic
1016605722 6:145922670-145922692 GAGGAAGTCTGGCTGGTCGGAGG + Exonic
1019416418 7:929002-929024 GAGGAATGCCGGCCGGGCGCGGG + Intronic
1019541965 7:1555630-1555652 GAGGGAGCCGGGCCTGGCGCTGG - Intronic
1024920701 7:54550917-54550939 GAGGAAATCGGGACGGCCGCGGG - Intronic
1031959124 7:127973022-127973044 GAGGAAGTCTGGCTGGGAGGTGG + Intronic
1034390802 7:150786162-150786184 GAGGAAGTGGGGCCGGGAGAGGG + Intergenic
1035623398 8:1052162-1052184 CAGGAAGGGCGGCCGGGCCCAGG - Intergenic
1039608398 8:38901126-38901148 GAGGGGGTGCGGCCGGGCGCCGG - Intergenic
1046196210 8:110866295-110866317 AATGAAGTCAGGCCGGGGGCAGG + Intergenic
1049780951 8:144428645-144428667 CCCGAAGTCCGGGCGGGCGCGGG - Intergenic
1049989444 9:977473-977495 GCGGGAGTTTGGCCGGGCGCGGG + Intronic
1052799689 9:32956109-32956131 GAGGGAGACCGGCCGAGAGCTGG - Intergenic
1053732911 9:41074928-41074950 TAGGGAGACGGGCCGGGCGCCGG - Intergenic
1054695517 9:68356626-68356648 CAGGGAGACGGGCCGGGCGCCGG + Intronic
1059137857 9:111824244-111824266 GCAAAAGACCGGCCGGGCGCAGG + Intergenic
1060468674 9:123929964-123929986 GAGGGAGGCCGGTCGGCCGCGGG - Exonic
1060931060 9:127489834-127489856 GGGGAAGTCCTGCCTGGAGCAGG - Intronic
1062060531 9:134493049-134493071 GAGGAGGTGGGGCCGGGGGCAGG + Intergenic
1062391195 9:136334615-136334637 GAAGGAGCACGGCCGGGCGCTGG + Exonic
1062621189 9:137423255-137423277 GCGGAAGTCCGGCCGGGGCGGGG + Exonic
1203654276 Un_KI270752v1:8113-8135 GAGGAAGTCCCGCCCGCCCCCGG + Intergenic
1185791137 X:2928904-2928926 GAGGAAGGCTGGCCGGGACCCGG - Intronic
1186867432 X:13734492-13734514 GAGCAAGTGCGGCGGGGGGCGGG - Intronic
1192818348 X:74617296-74617318 GATAAATACCGGCCGGGCGCAGG + Intergenic
1196825148 X:119734976-119734998 GAGGAAGTCCTGCCAAGGGCTGG - Intergenic
1198079762 X:133228128-133228150 CAGGAAGTCAGGCTGGGAGCTGG + Intergenic