ID: 1134168447

View in Genome Browser
Species Human (GRCh38)
Location 16:11949034-11949056
Sequence TGTAAGGGAGGCGGCTGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134168438_1134168447 6 Left 1134168438 16:11949005-11949027 CCTGCCGCATGCCTGTAATCCCA No data
Right 1134168447 16:11949034-11949056 TGTAAGGGAGGCGGCTGAGATGG No data
1134168439_1134168447 2 Left 1134168439 16:11949009-11949031 CCGCATGCCTGTAATCCCAGCTT No data
Right 1134168447 16:11949034-11949056 TGTAAGGGAGGCGGCTGAGATGG No data
1134168440_1134168447 -5 Left 1134168440 16:11949016-11949038 CCTGTAATCCCAGCTTCTTGTAA No data
Right 1134168447 16:11949034-11949056 TGTAAGGGAGGCGGCTGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134168447 Original CRISPR TGTAAGGGAGGCGGCTGAGA TGG Intronic