ID: 1134173751

View in Genome Browser
Species Human (GRCh38)
Location 16:11989723-11989745
Sequence GATTATGCATTGTGAGCTCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134173751_1134173760 14 Left 1134173751 16:11989723-11989745 CCGAGAGCTCACAATGCATAATC No data
Right 1134173760 16:11989760-11989782 GATTACATCAGCGCTATGGCAGG No data
1134173751_1134173762 23 Left 1134173751 16:11989723-11989745 CCGAGAGCTCACAATGCATAATC No data
Right 1134173762 16:11989769-11989791 AGCGCTATGGCAGGACTGCAGGG No data
1134173751_1134173752 -10 Left 1134173751 16:11989723-11989745 CCGAGAGCTCACAATGCATAATC No data
Right 1134173752 16:11989736-11989758 ATGCATAATCCCTCCCACGATGG 0: 1
1: 0
2: 2
3: 14
4: 67
1134173751_1134173764 30 Left 1134173751 16:11989723-11989745 CCGAGAGCTCACAATGCATAATC No data
Right 1134173764 16:11989776-11989798 TGGCAGGACTGCAGGGCCATGGG No data
1134173751_1134173753 -9 Left 1134173751 16:11989723-11989745 CCGAGAGCTCACAATGCATAATC No data
Right 1134173753 16:11989737-11989759 TGCATAATCCCTCCCACGATGGG No data
1134173751_1134173763 29 Left 1134173751 16:11989723-11989745 CCGAGAGCTCACAATGCATAATC No data
Right 1134173763 16:11989775-11989797 ATGGCAGGACTGCAGGGCCATGG No data
1134173751_1134173761 22 Left 1134173751 16:11989723-11989745 CCGAGAGCTCACAATGCATAATC No data
Right 1134173761 16:11989768-11989790 CAGCGCTATGGCAGGACTGCAGG No data
1134173751_1134173754 -8 Left 1134173751 16:11989723-11989745 CCGAGAGCTCACAATGCATAATC No data
Right 1134173754 16:11989738-11989760 GCATAATCCCTCCCACGATGGGG No data
1134173751_1134173759 10 Left 1134173751 16:11989723-11989745 CCGAGAGCTCACAATGCATAATC No data
Right 1134173759 16:11989756-11989778 TGGGGATTACATCAGCGCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134173751 Original CRISPR GATTATGCATTGTGAGCTCT CGG (reversed) Intronic
No off target data available for this crispr