ID: 1134179611

View in Genome Browser
Species Human (GRCh38)
Location 16:12036994-12037016
Sequence CACCACCGCTTCTCTGTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134179606_1134179611 4 Left 1134179606 16:12036967-12036989 CCAAATCTGTCTCCATCTGTCGT No data
Right 1134179611 16:12036994-12037016 CACCACCGCTTCTCTGTGGTTGG No data
1134179604_1134179611 11 Left 1134179604 16:12036960-12036982 CCTTCTCCCAAATCTGTCTCCAT No data
Right 1134179611 16:12036994-12037016 CACCACCGCTTCTCTGTGGTTGG No data
1134179607_1134179611 -8 Left 1134179607 16:12036979-12037001 CCATCTGTCGTCCCTCACCACCG No data
Right 1134179611 16:12036994-12037016 CACCACCGCTTCTCTGTGGTTGG No data
1134179605_1134179611 5 Left 1134179605 16:12036966-12036988 CCCAAATCTGTCTCCATCTGTCG No data
Right 1134179611 16:12036994-12037016 CACCACCGCTTCTCTGTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134179611 Original CRISPR CACCACCGCTTCTCTGTGGT TGG Intronic
No off target data available for this crispr