ID: 1134179678

View in Genome Browser
Species Human (GRCh38)
Location 16:12037385-12037407
Sequence CAGTCTCAGCCCTGGACCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134179678_1134179686 24 Left 1134179678 16:12037385-12037407 CCTGTGGTCCAGGGCTGAGACTG No data
Right 1134179686 16:12037432-12037454 TTTGGCCACAAAATTGAAGGCGG No data
1134179678_1134179684 6 Left 1134179678 16:12037385-12037407 CCTGTGGTCCAGGGCTGAGACTG No data
Right 1134179684 16:12037414-12037436 GGTTAGTGAGACACTCACTTTGG No data
1134179678_1134179685 21 Left 1134179678 16:12037385-12037407 CCTGTGGTCCAGGGCTGAGACTG No data
Right 1134179685 16:12037429-12037451 CACTTTGGCCACAAAATTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134179678 Original CRISPR CAGTCTCAGCCCTGGACCAC AGG (reversed) Intronic
No off target data available for this crispr