ID: 1134179791

View in Genome Browser
Species Human (GRCh38)
Location 16:12038264-12038286
Sequence CTGAACTAGAATTTGGGACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134179787_1134179791 -6 Left 1134179787 16:12038247-12038269 CCAAGGTCACACAGTGCCTGAAC No data
Right 1134179791 16:12038264-12038286 CTGAACTAGAATTTGGGACAAGG No data
1134179786_1134179791 -5 Left 1134179786 16:12038246-12038268 CCCAAGGTCACACAGTGCCTGAA No data
Right 1134179791 16:12038264-12038286 CTGAACTAGAATTTGGGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134179791 Original CRISPR CTGAACTAGAATTTGGGACA AGG Intronic
No off target data available for this crispr