ID: 1134182782

View in Genome Browser
Species Human (GRCh38)
Location 16:12061229-12061251
Sequence AGGGAGCCTGCAGTCTGTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134182782_1134182792 24 Left 1134182782 16:12061229-12061251 CCCCAACAGACTGCAGGCTCCCT No data
Right 1134182792 16:12061276-12061298 TGGCTCTTTTGCCACCAGTAGGG No data
1134182782_1134182791 23 Left 1134182782 16:12061229-12061251 CCCCAACAGACTGCAGGCTCCCT No data
Right 1134182791 16:12061275-12061297 CTGGCTCTTTTGCCACCAGTAGG No data
1134182782_1134182790 4 Left 1134182782 16:12061229-12061251 CCCCAACAGACTGCAGGCTCCCT No data
Right 1134182790 16:12061256-12061278 GCAGGATCAACAGTATTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134182782 Original CRISPR AGGGAGCCTGCAGTCTGTTG GGG (reversed) Intronic
No off target data available for this crispr