ID: 1134184915

View in Genome Browser
Species Human (GRCh38)
Location 16:12077099-12077121
Sequence GTTGTTTTATTTGTAAAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134184915_1134184920 30 Left 1134184915 16:12077099-12077121 CCTGTCTTTACAAATAAAACAAC No data
Right 1134184920 16:12077152-12077174 GCCTGTAGTGTCAGCTACTTGGG 0: 23
1: 2074
2: 42666
3: 181752
4: 270254
1134184915_1134184917 2 Left 1134184915 16:12077099-12077121 CCTGTCTTTACAAATAAAACAAC No data
Right 1134184917 16:12077124-12077146 CAAAAATTATCCAGATGTGGTGG 0: 31
1: 1742
2: 20667
3: 61025
4: 134179
1134184915_1134184919 29 Left 1134184915 16:12077099-12077121 CCTGTCTTTACAAATAAAACAAC No data
Right 1134184919 16:12077151-12077173 TGCCTGTAGTGTCAGCTACTTGG 0: 23
1: 2371
2: 42895
3: 146388
4: 150865
1134184915_1134184916 -1 Left 1134184915 16:12077099-12077121 CCTGTCTTTACAAATAAAACAAC No data
Right 1134184916 16:12077121-12077143 CAACAAAAATTATCCAGATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134184915 Original CRISPR GTTGTTTTATTTGTAAAGAC AGG (reversed) Intronic
No off target data available for this crispr