ID: 1134194381

View in Genome Browser
Species Human (GRCh38)
Location 16:12147822-12147844
Sequence CCTGCAGGGCATTCACATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134194381_1134194388 29 Left 1134194381 16:12147822-12147844 CCAGGATGTGAATGCCCTGCAGG No data
Right 1134194388 16:12147874-12147896 CAAGCAACTTCTTTTTATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134194381 Original CRISPR CCTGCAGGGCATTCACATCC TGG (reversed) Intronic
No off target data available for this crispr