ID: 1134198137

View in Genome Browser
Species Human (GRCh38)
Location 16:12174950-12174972
Sequence ATCTTGTCCCTGAGGTAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134198133_1134198137 24 Left 1134198133 16:12174903-12174925 CCTATAAATGGAAAGTATTATTA No data
Right 1134198137 16:12174950-12174972 ATCTTGTCCCTGAGGTAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134198137 Original CRISPR ATCTTGTCCCTGAGGTAAGA GGG Intronic
No off target data available for this crispr