ID: 1134205510

View in Genome Browser
Species Human (GRCh38)
Location 16:12234492-12234514
Sequence AACTTGCAGAATGGTAGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134205510_1134205512 -3 Left 1134205510 16:12234492-12234514 CCTTTTCTACCATTCTGCAAGTT No data
Right 1134205512 16:12234512-12234534 GTTTCTTTTCATTTTCTCGATGG No data
1134205510_1134205513 8 Left 1134205510 16:12234492-12234514 CCTTTTCTACCATTCTGCAAGTT No data
Right 1134205513 16:12234523-12234545 TTTTCTCGATGGTGTCCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134205510 Original CRISPR AACTTGCAGAATGGTAGAAA AGG (reversed) Intronic