ID: 1134205511

View in Genome Browser
Species Human (GRCh38)
Location 16:12234501-12234523
Sequence ATGAAAAGAAACTTGCAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134205511_1134205513 -1 Left 1134205511 16:12234501-12234523 CCATTCTGCAAGTTTCTTTTCAT No data
Right 1134205513 16:12234523-12234545 TTTTCTCGATGGTGTCCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134205511 Original CRISPR ATGAAAAGAAACTTGCAGAA TGG (reversed) Intronic