ID: 1134206114

View in Genome Browser
Species Human (GRCh38)
Location 16:12239125-12239147
Sequence GGCACATGGCCTTTCTGAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134206111_1134206114 20 Left 1134206111 16:12239082-12239104 CCACTTTGATGGAAGGGGCGTGT No data
Right 1134206114 16:12239125-12239147 GGCACATGGCCTTTCTGAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134206114 Original CRISPR GGCACATGGCCTTTCTGAAT AGG Intronic
No off target data available for this crispr