ID: 1134207921

View in Genome Browser
Species Human (GRCh38)
Location 16:12252782-12252804
Sequence CACCAAAGGCTCCCCATGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134207921_1134207930 21 Left 1134207921 16:12252782-12252804 CCAGCCATGGGGAGCCTTTGGTG No data
Right 1134207930 16:12252826-12252848 GCAGCACGGTGCCCACAGTGAGG No data
1134207921_1134207928 7 Left 1134207921 16:12252782-12252804 CCAGCCATGGGGAGCCTTTGGTG No data
Right 1134207928 16:12252812-12252834 AGCTGTGTCTCCAAGCAGCACGG No data
1134207921_1134207931 22 Left 1134207921 16:12252782-12252804 CCAGCCATGGGGAGCCTTTGGTG No data
Right 1134207931 16:12252827-12252849 CAGCACGGTGCCCACAGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134207921 Original CRISPR CACCAAAGGCTCCCCATGGC TGG (reversed) Intronic
No off target data available for this crispr