ID: 1134211974

View in Genome Browser
Species Human (GRCh38)
Location 16:12285195-12285217
Sequence CCTGCTAAACAGTGAGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134211974_1134211982 27 Left 1134211974 16:12285195-12285217 CCTTCCACTCACTGTTTAGCAGG No data
Right 1134211982 16:12285245-12285267 CTCTCCCAGCTCTTGCTTGCCGG No data
1134211974_1134211978 3 Left 1134211974 16:12285195-12285217 CCTTCCACTCACTGTTTAGCAGG No data
Right 1134211978 16:12285221-12285243 TAGCTCCCTCATGTTGTCTTCGG No data
1134211974_1134211979 4 Left 1134211974 16:12285195-12285217 CCTTCCACTCACTGTTTAGCAGG No data
Right 1134211979 16:12285222-12285244 AGCTCCCTCATGTTGTCTTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134211974 Original CRISPR CCTGCTAAACAGTGAGTGGA AGG (reversed) Intronic
No off target data available for this crispr