ID: 1134212610

View in Genome Browser
Species Human (GRCh38)
Location 16:12290328-12290350
Sequence GGGTTCATAAAAAAAGAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134212610_1134212617 29 Left 1134212610 16:12290328-12290350 CCCTGTTCTTTTTTTATGAACCC No data
Right 1134212617 16:12290380-12290402 TGATCTTTCAGATCTCATCCTGG No data
1134212610_1134212614 -2 Left 1134212610 16:12290328-12290350 CCCTGTTCTTTTTTTATGAACCC No data
Right 1134212614 16:12290349-12290371 CCTTTCCTGTCCGTTTTCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134212610 Original CRISPR GGGTTCATAAAAAAAGAACA GGG (reversed) Intronic
No off target data available for this crispr