ID: 1134213406

View in Genome Browser
Species Human (GRCh38)
Location 16:12297014-12297036
Sequence ATCACAAATGTCTCCAGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134213399_1134213406 0 Left 1134213399 16:12296991-12297013 CCCCCTTCCCCACAACTGTGATA No data
Right 1134213406 16:12297014-12297036 ATCACAAATGTCTCCAGACATGG No data
1134213401_1134213406 -2 Left 1134213401 16:12296993-12297015 CCCTTCCCCACAACTGTGATAAT No data
Right 1134213406 16:12297014-12297036 ATCACAAATGTCTCCAGACATGG No data
1134213398_1134213406 19 Left 1134213398 16:12296972-12296994 CCGCTAGATGCTGGTGGCACCCC No data
Right 1134213406 16:12297014-12297036 ATCACAAATGTCTCCAGACATGG No data
1134213404_1134213406 -8 Left 1134213404 16:12296999-12297021 CCCACAACTGTGATAATCACAAA No data
Right 1134213406 16:12297014-12297036 ATCACAAATGTCTCCAGACATGG No data
1134213400_1134213406 -1 Left 1134213400 16:12296992-12297014 CCCCTTCCCCACAACTGTGATAA No data
Right 1134213406 16:12297014-12297036 ATCACAAATGTCTCCAGACATGG No data
1134213397_1134213406 20 Left 1134213397 16:12296971-12296993 CCCGCTAGATGCTGGTGGCACCC No data
Right 1134213406 16:12297014-12297036 ATCACAAATGTCTCCAGACATGG No data
1134213403_1134213406 -7 Left 1134213403 16:12296998-12297020 CCCCACAACTGTGATAATCACAA No data
Right 1134213406 16:12297014-12297036 ATCACAAATGTCTCCAGACATGG No data
1134213402_1134213406 -3 Left 1134213402 16:12296994-12297016 CCTTCCCCACAACTGTGATAATC No data
Right 1134213406 16:12297014-12297036 ATCACAAATGTCTCCAGACATGG No data
1134213405_1134213406 -9 Left 1134213405 16:12297000-12297022 CCACAACTGTGATAATCACAAAT No data
Right 1134213406 16:12297014-12297036 ATCACAAATGTCTCCAGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134213406 Original CRISPR ATCACAAATGTCTCCAGACA TGG Intronic
No off target data available for this crispr