ID: 1134215147

View in Genome Browser
Species Human (GRCh38)
Location 16:12311489-12311511
Sequence GGCCGCCTCCCATTTCCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134215144_1134215147 4 Left 1134215144 16:12311462-12311484 CCTCTGCTGGCTGGACTGCACCA No data
Right 1134215147 16:12311489-12311511 GGCCGCCTCCCATTTCCTCCAGG No data
1134215138_1134215147 27 Left 1134215138 16:12311439-12311461 CCTCCTTTCCTGGCTCCTGGCTT No data
Right 1134215147 16:12311489-12311511 GGCCGCCTCCCATTTCCTCCAGG No data
1134215143_1134215147 12 Left 1134215143 16:12311454-12311476 CCTGGCTTCCTCTGCTGGCTGGA No data
Right 1134215147 16:12311489-12311511 GGCCGCCTCCCATTTCCTCCAGG No data
1134215140_1134215147 19 Left 1134215140 16:12311447-12311469 CCTGGCTCCTGGCTTCCTCTGCT No data
Right 1134215147 16:12311489-12311511 GGCCGCCTCCCATTTCCTCCAGG No data
1134215139_1134215147 24 Left 1134215139 16:12311442-12311464 CCTTTCCTGGCTCCTGGCTTCCT No data
Right 1134215147 16:12311489-12311511 GGCCGCCTCCCATTTCCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134215147 Original CRISPR GGCCGCCTCCCATTTCCTCC AGG Intronic
No off target data available for this crispr