ID: 1134217675

View in Genome Browser
Species Human (GRCh38)
Location 16:12328801-12328823
Sequence TAGGCAAAGATGGAGTTGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134217672_1134217675 1 Left 1134217672 16:12328777-12328799 CCACAAATGCTTCTTTAAATGAT No data
Right 1134217675 16:12328801-12328823 TAGGCAAAGATGGAGTTGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134217675 Original CRISPR TAGGCAAAGATGGAGTTGAT TGG Intronic
No off target data available for this crispr