ID: 1134220342

View in Genome Browser
Species Human (GRCh38)
Location 16:12348618-12348640
Sequence TGAAGAGCAGAGGACCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 382
Summary {0: 1, 1: 0, 2: 1, 3: 49, 4: 331}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134220342_1134220347 16 Left 1134220342 16:12348618-12348640 CCTTCCAGGTCCTCTGCTCTTCA 0: 1
1: 0
2: 1
3: 49
4: 331
Right 1134220347 16:12348657-12348679 CTAGCTCAGCATCACAGTGATGG No data
1134220342_1134220348 30 Left 1134220342 16:12348618-12348640 CCTTCCAGGTCCTCTGCTCTTCA 0: 1
1: 0
2: 1
3: 49
4: 331
Right 1134220348 16:12348671-12348693 CAGTGATGGCGTATGCTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134220342 Original CRISPR TGAAGAGCAGAGGACCTGGA AGG (reversed) Intronic