ID: 1134225289

View in Genome Browser
Species Human (GRCh38)
Location 16:12385394-12385416
Sequence AAAAAAATTCCAACTCTTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134225289_1134225295 12 Left 1134225289 16:12385394-12385416 CCTCAAAGAGTTGGAATTTTTTT No data
Right 1134225295 16:12385429-12385451 GAATTCACATTGTGTCCCGCAGG No data
1134225289_1134225297 20 Left 1134225289 16:12385394-12385416 CCTCAAAGAGTTGGAATTTTTTT No data
Right 1134225297 16:12385437-12385459 ATTGTGTCCCGCAGGGCTCTAGG No data
1134225289_1134225296 13 Left 1134225289 16:12385394-12385416 CCTCAAAGAGTTGGAATTTTTTT No data
Right 1134225296 16:12385430-12385452 AATTCACATTGTGTCCCGCAGGG No data
1134225289_1134225294 -10 Left 1134225289 16:12385394-12385416 CCTCAAAGAGTTGGAATTTTTTT No data
Right 1134225294 16:12385407-12385429 GAATTTTTTTCATGGGGCGGTGG No data
1134225289_1134225298 21 Left 1134225289 16:12385394-12385416 CCTCAAAGAGTTGGAATTTTTTT No data
Right 1134225298 16:12385438-12385460 TTGTGTCCCGCAGGGCTCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134225289 Original CRISPR AAAAAAATTCCAACTCTTTG AGG (reversed) Intronic