ID: 1134225297

View in Genome Browser
Species Human (GRCh38)
Location 16:12385437-12385459
Sequence ATTGTGTCCCGCAGGGCTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134225289_1134225297 20 Left 1134225289 16:12385394-12385416 CCTCAAAGAGTTGGAATTTTTTT No data
Right 1134225297 16:12385437-12385459 ATTGTGTCCCGCAGGGCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134225297 Original CRISPR ATTGTGTCCCGCAGGGCTCT AGG Intronic