ID: 1134228177

View in Genome Browser
Species Human (GRCh38)
Location 16:12408308-12408330
Sequence CCAAGCCAGGACTTTTCCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134228169_1134228177 11 Left 1134228169 16:12408274-12408296 CCCCTGAGATGGTAGGCTAAGGG No data
Right 1134228177 16:12408308-12408330 CCAAGCCAGGACTTTTCCATAGG No data
1134228165_1134228177 20 Left 1134228165 16:12408265-12408287 CCACCTACACCCCTGAGATGGTA No data
Right 1134228177 16:12408308-12408330 CCAAGCCAGGACTTTTCCATAGG No data
1134228167_1134228177 17 Left 1134228167 16:12408268-12408290 CCTACACCCCTGAGATGGTAGGC No data
Right 1134228177 16:12408308-12408330 CCAAGCCAGGACTTTTCCATAGG No data
1134228172_1134228177 9 Left 1134228172 16:12408276-12408298 CCTGAGATGGTAGGCTAAGGGCA No data
Right 1134228177 16:12408308-12408330 CCAAGCCAGGACTTTTCCATAGG No data
1134228171_1134228177 10 Left 1134228171 16:12408275-12408297 CCCTGAGATGGTAGGCTAAGGGC No data
Right 1134228177 16:12408308-12408330 CCAAGCCAGGACTTTTCCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134228177 Original CRISPR CCAAGCCAGGACTTTTCCAT AGG Intronic
No off target data available for this crispr