ID: 1134233744

View in Genome Browser
Species Human (GRCh38)
Location 16:12449606-12449628
Sequence GGAGATGCACAGCTGGAGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 336
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 303}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134233744 Original CRISPR GGAGATGCACAGCTGGAGCA CGG (reversed) Intronic
900161041 1:1223910-1223932 GGAGATGCAGCGCTGGATCATGG - Exonic
900610223 1:3541590-3541612 GGAGAGGCACAGCTGGCCCGAGG + Intronic
900713519 1:4129726-4129748 GGAGATGCAGACCGGGAGCCTGG + Intergenic
900808004 1:4780531-4780553 GGTGGGGCACAGCTGGAGTAAGG + Intronic
900868637 1:5286280-5286302 GGAGATGCAGAGCTGTACAAGGG + Intergenic
902333307 1:15741487-15741509 GGAGCTGAACAGGTGGACCACGG - Intergenic
902407440 1:16192323-16192345 AGAGCTGCACAGCCAGAGCATGG - Intergenic
903020341 1:20389290-20389312 GGAGGAGCAGGGCTGGAGCAGGG + Intergenic
904195976 1:28785724-28785746 GAAGAGGCACAGCTGGGTCAGGG + Intergenic
904412314 1:30331890-30331912 GGGGCTGCTCAGCTGGAGAAGGG - Intergenic
905022391 1:34826821-34826843 GGAGATGCTCAGCTCAATCATGG - Intronic
905031008 1:34884717-34884739 GGAGATACACAGCAGTTGCAGGG - Intronic
905812520 1:40923136-40923158 GCAGTTGCAGAGCTGGAGCTGGG + Intergenic
906057932 1:42930647-42930669 GACGATGCCCAGCTGGTGCAGGG + Exonic
906605153 1:47164132-47164154 GGCCATGCAAAGATGGAGCAGGG - Intergenic
906874537 1:49522797-49522819 GTAGAAGCACAGCATGAGCACGG + Intronic
907053440 1:51344882-51344904 TGAGAGGCACAGCTGGGGAAAGG - Intronic
907474787 1:54698503-54698525 GGGGAGGCAGAGCTGGAGGAGGG - Intronic
907773997 1:57494862-57494884 GGAATTTCACAGCTGAAGCAAGG - Intronic
911169454 1:94755938-94755960 GGAGATCCAGTGCTGGAGCTGGG + Intergenic
911643453 1:100313644-100313666 AGAGATGAATAGGTGGAGCACGG - Intergenic
912313525 1:108646395-108646417 GGAGATGCAGAGTTGGTGCCTGG - Intergenic
913611550 1:120514204-120514226 GCAGATGCAGAGGTGGGGCAGGG - Intergenic
913983244 1:143542603-143542625 GCAGATGCAGAGGTGGGGCAGGG + Intergenic
914453586 1:147815051-147815073 GGAGATGCCCAGGAGAAGCATGG - Intergenic
914579642 1:149008035-149008057 GCAGATGCAGAGGTGGGGCAGGG + Intronic
915446688 1:155978289-155978311 GGAGATGCACCGCGGGTGCCGGG + Intronic
917702704 1:177597273-177597295 AGAGATGCACAGCAAGAACAGGG + Intergenic
918213353 1:182371263-182371285 GGAAATGCAAAGCTGCTGCAAGG - Intergenic
921213484 1:212918876-212918898 GAAGAAGCCCAGCTGGTGCATGG + Intergenic
922340737 1:224652958-224652980 GGAAATTCCCAGCTGGAGGAAGG + Intronic
923909983 1:238430882-238430904 GTAGATGGAGAGCCGGAGCATGG + Intergenic
924603358 1:245510805-245510827 GGAAATGCAATGTTGGAGCAGGG + Intronic
1064596706 10:16952969-16952991 ATAGAGGCTCAGCTGGAGCATGG + Intronic
1065299742 10:24310648-24310670 TTAGAGGCACACCTGGAGCAAGG - Intronic
1067660352 10:48232769-48232791 GAAGAGACAGAGCTGGAGCAAGG + Intronic
1067789599 10:49277757-49277779 AGAGATGCACAGCTGGGTCTGGG - Intergenic
1068264918 10:54633976-54633998 GGAGATTCATGGCTGGTGCATGG - Intronic
1069840130 10:71334695-71334717 GGAGGTGCACTGCGGGATCACGG - Intronic
1070705608 10:78635729-78635751 GGAGCTGCAGATCTGGAGCTGGG + Intergenic
1071390581 10:85171437-85171459 GGAGATTCTCACCTGGAGTAGGG + Intergenic
1071446078 10:85748752-85748774 GGAGATGTCAAGCTGGAGCCTGG - Intronic
1071917045 10:90305129-90305151 GGAGAGGTAGAGCTGGAGAAGGG - Intergenic
1073870706 10:107860895-107860917 GGACATGCACAGCTGGTCAATGG - Intergenic
1074407227 10:113189962-113189984 GGAGAGGGACAGCTGGTACAAGG - Intergenic
1078026999 11:7705615-7705637 GGAGACACACAGCTGGATAATGG + Intronic
1079242209 11:18729037-18729059 AGAGATGCACAGTGGGGGCAGGG + Intronic
1081256243 11:40899230-40899252 GTAGATGCACAGCTGAAGAAAGG - Intronic
1084329131 11:68419928-68419950 GGAGGTGCACAACTTGAGCCTGG - Intronic
1084412671 11:69013449-69013471 GGAGATGAACAGCTGGACTCGGG - Intergenic
1085045090 11:73347982-73348004 GGAGAAGCACAACTGGAGCAAGG + Intronic
1085751226 11:79162822-79162844 GCAGATGAACAGCTGGCCCAGGG - Intronic
1088650672 11:111955401-111955423 GCTGATCCAGAGCTGGAGCAGGG + Intronic
1089389259 11:118088915-118088937 GAAGATGCAAAGCTGAAACAAGG - Intronic
1090329426 11:125919123-125919145 GGAAATGAACTGCTGGTGCATGG - Intronic
1090425186 11:126602669-126602691 GCGGATCCACAGCTGGGGCAGGG - Intronic
1092162820 12:6325283-6325305 GGAGAAGCAGAGCTGGGACAGGG - Intronic
1092567094 12:9678016-9678038 GGAAATGCACAGATCCAGCAGGG - Intronic
1092732020 12:11544035-11544057 GGAGCTGCACAGCAGGAGTGTGG + Intergenic
1092954299 12:13535260-13535282 GGGGGTGCTCAGCTGGAGCCAGG - Intergenic
1092989395 12:13880386-13880408 GGGGATGCTCAGCTGGCGCTCGG + Intronic
1093353334 12:18130847-18130869 GGACATGTACAGCTGGAGGAAGG - Intronic
1094424154 12:30301467-30301489 GGAGAGGCACTGCAGGAGGAGGG + Intergenic
1095672653 12:44877944-44877966 TTAGATGCACAGCTGTAGAAAGG - Intronic
1096186037 12:49581153-49581175 GGATATGTAGAACTGGAGCATGG + Intronic
1097081004 12:56430824-56430846 GGAGTTGCATAGCTTAAGCAGGG - Intronic
1097107198 12:56632856-56632878 GGAGAAGCACAGCTGCAGCATGG - Intronic
1098351241 12:69563344-69563366 GGATAGACACAGCTGGAACATGG - Intronic
1098603846 12:72365976-72365998 GAAGATGCAAAGATGGAGAAAGG - Intronic
1099939464 12:89168259-89168281 GGAGAGGCAGAGCTGGACAAGGG - Intergenic
1101303310 12:103503506-103503528 GCAGATGCACAGCGTGACCAGGG - Intergenic
1102226764 12:111234303-111234325 GGAGCAGCAAAGCAGGAGCAAGG + Intronic
1103004064 12:117407774-117407796 GGCAGTGCACAGCGGGAGCATGG - Intronic
1103693107 12:122791795-122791817 GGAGAGGCAAGGCTGGTGCAGGG + Intronic
1104033125 12:125079365-125079387 GGGGACGCAGAGCTGGAGCACGG - Intronic
1104653088 12:130551676-130551698 GAAAATGCACAGATAGAGCAAGG + Intronic
1104732542 12:131115938-131115960 GTAGATGCACAGCTGGTCCCGGG + Intronic
1104941771 12:132398569-132398591 GGAGGGACACGGCTGGAGCATGG - Intergenic
1105899476 13:24743085-24743107 GAAGATGCACAGCAGGAGGAGGG - Intergenic
1106823097 13:33488303-33488325 GGAGAAGCACACCTGGATGAGGG - Intergenic
1108044449 13:46370166-46370188 GCAGAGGCACAGCTGGTGAACGG - Intronic
1110568171 13:76977173-76977195 GGAGATTTTAAGCTGGAGCAAGG - Intergenic
1113069947 13:106410573-106410595 TGATAGGCACAGCTGGACCAGGG + Intergenic
1113381735 13:109811374-109811396 GGGGACACACAGCTGGTGCAAGG - Intergenic
1113650931 13:112033757-112033779 GGAGATGACCACCTGCAGCAAGG + Intergenic
1114216826 14:20663516-20663538 AGAGATGCACAGGTGGAGGAAGG - Intergenic
1117166819 14:53043137-53043159 GGTGATGCAAAGCTGGAATATGG + Intronic
1117285613 14:54283115-54283137 GGGGAGGCACAGCTGGGGCTGGG - Intergenic
1118468541 14:66053840-66053862 GGAGATGCACTACAGGAGAATGG - Intergenic
1119190580 14:72679462-72679484 GGAGCTGCTCAGCTGGGGCTGGG - Intronic
1119933193 14:78567426-78567448 GAAGATCCAGAGATGGAGCAGGG - Intronic
1122130803 14:99603875-99603897 GGAGCTGCTGCGCTGGAGCAAGG - Exonic
1122349328 14:101078339-101078361 AGAGGTGAACAGCTGGAGCCAGG - Intergenic
1122384528 14:101334868-101334890 GGAGTTGGAAGGCTGGAGCACGG - Intergenic
1202891576 14_KI270722v1_random:164125-164147 GGAGAAGCAAAACTGTAGCAGGG + Intergenic
1124047249 15:26161678-26161700 GGATATGGACAGCTGCAGGAAGG + Intergenic
1125362243 15:38876458-38876480 GGAGAGGAGCAGCTGGAGAATGG + Intergenic
1125978172 15:43974285-43974307 GGAGGTGAACAGCTTGAGCAAGG + Intronic
1126648401 15:50897585-50897607 CCAGGTGCACTGCTGGAGCAGGG + Intergenic
1127335644 15:57980529-57980551 AGAGCTTCACAGCTGGATCAAGG - Intronic
1128334170 15:66775523-66775545 GGAGATGACCTGCTGGATCAGGG + Intronic
1128369485 15:67029994-67030016 GGAGATGCCCAATTAGAGCAGGG + Intergenic
1129994007 15:79989331-79989353 GGTGATGCAGAGCTGGGGGAGGG - Intergenic
1130931786 15:88433890-88433912 GGAGATGAACAGACAGAGCAGGG - Intergenic
1132675736 16:1120599-1120621 GGAGACGCACAGGTGGGGCCGGG + Intergenic
1133440545 16:5817583-5817605 GGAGAAGCCCAGCTGGAGAGGGG + Intergenic
1133868456 16:9665965-9665987 GGATATGCAGAGCTGAAGCTTGG - Intergenic
1134233744 16:12449606-12449628 GGAGATGCACAGCTGGAGCACGG - Intronic
1135784242 16:25334235-25334257 GGTCATTCACACCTGGAGCAGGG + Intergenic
1135954076 16:26940998-26941020 CGAGGGGCACAGCTGGAGGAGGG + Intergenic
1137585323 16:49660808-49660830 GGAGACACAGAGCTGGGGCAGGG + Intronic
1137618704 16:49861639-49861661 GCAGATGCAAAACTGGAACACGG - Intergenic
1138137196 16:54533290-54533312 GGAGCTGCTCAGCTGGAGCTGGG + Intergenic
1139314803 16:66059114-66059136 AGAGATGATCAGCTGGAGAAAGG - Intergenic
1139326502 16:66156467-66156489 GGAAATGCACAGCTGCAGTCTGG + Intergenic
1139407636 16:66731572-66731594 GGACATACACAGCTGAAGAAGGG - Intronic
1140876027 16:79153269-79153291 GGAGTCTCACAGCTGGAGAAAGG - Intronic
1141728993 16:85809441-85809463 GGAGAAGCATAGCTGTAGCCAGG + Intergenic
1142145683 16:88492012-88492034 AGAGATGCTCAGGAGGAGCAGGG - Intronic
1142983088 17:3682530-3682552 GGAGATGCGCTTCTGGAGAAGGG + Intronic
1143135863 17:4711910-4711932 GGAGGTGCCCAGTGGGAGCAGGG - Intronic
1143239732 17:5433806-5433828 GGAGATGGATGGCTGGATCAAGG + Intronic
1143331688 17:6141444-6141466 GGAGTTGCATAGGTGGTGCACGG + Intergenic
1143537802 17:7551568-7551590 GAAGAGGCACACCGGGAGCAGGG - Intronic
1143748471 17:9011198-9011220 GGACATGAGCAGCTTGAGCAAGG - Intergenic
1144455268 17:15413276-15413298 GGAGATGGACAGCTGGACAAAGG + Intergenic
1145777567 17:27540025-27540047 GGAAATGCAAAGCTTGAGCTGGG - Intronic
1146567862 17:33928767-33928789 GCAGATCCACAGATGGAGGAGGG + Intronic
1146744456 17:35314980-35315002 AGAGAGGCAGAGCTGGAGCAGGG - Intergenic
1147389202 17:40099135-40099157 CGAGAGGCACACGTGGAGCAGGG - Intronic
1147570249 17:41566089-41566111 GGGGATGCTCAGCTGGGGCTGGG + Exonic
1148154501 17:45415093-45415115 GGAGATGCAGAGCTGGGTCCAGG - Intronic
1151326632 17:73383742-73383764 GGAGAGGCACACATGGAGGAGGG + Intronic
1151880009 17:76889165-76889187 GAAGATGCAGGGCTGGCGCAGGG + Intronic
1152535497 17:80948407-80948429 GGAGATGCATAGTCGGGGCAGGG + Intronic
1153026657 18:679004-679026 GGAGGAGCGCAGCTGGAGCATGG - Intronic
1153152907 18:2114921-2114943 GCACATGCACAGCAGCAGCATGG + Intergenic
1153842022 18:9015906-9015928 GGAGAGCCAGAGCTGGAGCCAGG - Intergenic
1154040444 18:10849637-10849659 GGATATGCACACCTCGAGCTGGG + Intronic
1157170830 18:45403579-45403601 GCAGTGGCACAGATGGAGCATGG + Intronic
1157544753 18:48539635-48539657 GGGGACGCACGGCTGGAGCCCGG + Intronic
1157602296 18:48901764-48901786 TGAGATGCAGACCTGGAGCCTGG + Intergenic
1158407781 18:57175662-57175684 TTAAATGCAGAGCTGGAGCAAGG - Intergenic
1160360710 18:78274567-78274589 AGGGATGAACAGCTGAAGCATGG - Intergenic
1161641375 19:5425544-5425566 GGAGAAGCAGGGGTGGAGCAAGG - Intergenic
1163372454 19:16908978-16909000 GGATCTGCACAGCTGGGGCCGGG - Intronic
1163418503 19:17201390-17201412 GGAGCTGCACAGCGGGCACAGGG + Intronic
1163687001 19:18717414-18717436 ATAGATGCTGAGCTGGAGCAGGG + Intronic
1163953539 19:20613119-20613141 GCATTTGCACAGCTTGAGCATGG - Intronic
1164807477 19:31128075-31128097 GGACAAGCACAGGTGGACCAAGG - Intergenic
1165278308 19:34773518-34773540 AGAGATGAACTGCTGGCGCAGGG - Intergenic
1166002270 19:39884883-39884905 GGAGAGGACCAGCTGGACCAAGG + Intronic
1166005054 19:39901134-39901156 GGAGAGGACCAGCTGGACCAAGG + Intronic
1166769344 19:45271627-45271649 GGAGGTGGACATCTGGAGCCTGG + Exonic
1168586359 19:57596740-57596762 AGGGATGAACAGGTGGAGCACGG + Intergenic
924993972 2:340456-340478 GGAGGGGCACAGCTGGGTCAGGG - Intergenic
925384982 2:3455527-3455549 GGAGATGGAGAGCAGGAGGATGG - Intronic
925865544 2:8223224-8223246 GGACATGCACAGCAGGGGCCTGG + Intergenic
926297790 2:11581097-11581119 TGGGCTGCACAGCTGGAGGATGG + Intronic
927092580 2:19723299-19723321 GGAGAGGCACTGAGGGAGCACGG - Intergenic
927569794 2:24148901-24148923 GGAGATGCAGAGCGGAAGGATGG - Intronic
928392996 2:30923565-30923587 GGAGATGCAGAGGTGAAGCTGGG + Intronic
928417795 2:31111124-31111146 GGGGCTTCACAGCTGCAGCAGGG - Intronic
928997353 2:37307114-37307136 TTGGATGCACAACTGGAGCAGGG - Intronic
929246787 2:39710983-39711005 GTCGATGCACATCTGGAGCCAGG + Intronic
929790480 2:45018812-45018834 GGTGATGCACAGCTGCAGAAGGG - Intergenic
931269007 2:60685567-60685589 ACAGATGCCCAGCTGGAGAAAGG + Intergenic
931986957 2:67751429-67751451 GGACATGCGCAGGTGGTGCAAGG + Intergenic
932438490 2:71717105-71717127 ACAATTGCACAGCTGGAGCAGGG - Intergenic
933609352 2:84417525-84417547 GGAGATGCAGAGCTGTGGCAGGG + Intergenic
934791590 2:97066984-97067006 GGACAGGCACAGATAGAGCAAGG + Intergenic
935454473 2:103251246-103251268 GGGGATGGATAGATGGAGCACGG - Intergenic
937017153 2:118616652-118616674 GGGGGTGTAGAGCTGGAGCAGGG + Intergenic
937028685 2:118720345-118720367 GGAGCAGAATAGCTGGAGCAGGG - Intergenic
937342582 2:121100798-121100820 TGAGATGCACGGCTGGAGCTGGG - Intergenic
938195556 2:129324439-129324461 GGAGATGCAGAGCAGGAAGAGGG - Intergenic
940205676 2:151198948-151198970 GGAGATGCAATGCAGCAGCATGG + Intergenic
941992927 2:171574602-171574624 GGAGATGAATAGGTGGAGCACGG + Intergenic
945656637 2:212632210-212632232 GGAGAGCCACAGCTGAATCAGGG + Intergenic
947747672 2:232517392-232517414 AGAGATGCAGCCCTGGAGCAGGG + Intergenic
948221357 2:236272249-236272271 GGAGCTTCACCGCTGGGGCAGGG - Intergenic
948830083 2:240594402-240594424 GGGGCTGCAGAGCTGGGGCACGG + Intronic
1168811799 20:709692-709714 GGAGACTCACAGCGGGAGGAAGG + Intergenic
1170363679 20:15576397-15576419 GGAGATGCAGAGATAGAGGAAGG - Intronic
1170600346 20:17836777-17836799 GGAGCAGCACAGCTGGATCTTGG + Intergenic
1171306800 20:24113549-24113571 GGAGCTGGACAGCAGCAGCAGGG + Intergenic
1171485717 20:25484068-25484090 GGAGAGGCCCAGATGGAGAAGGG + Intronic
1172531284 20:35632885-35632907 GGAAATGGACAGCTGAACCAAGG + Exonic
1172844657 20:37922707-37922729 GGAGATTCAGGGCTGGACCAGGG + Intronic
1173663033 20:44747044-44747066 GGACGTTCACAGCTGGAGCCTGG - Intronic
1174087706 20:48020710-48020732 TGGGATGCACAGCTGGAAGAAGG + Intergenic
1174171307 20:48619742-48619764 AGAGATGAAGAGCTGGAGGAGGG - Intergenic
1175192115 20:57218382-57218404 GGAGCTGCACAGCTGGTGTTTGG + Intronic
1175790336 20:61736690-61736712 GGATATGCACAGCTGAAGAAGGG - Intronic
1179400676 21:41080319-41080341 GGAGAGGCAGAGCTGGTACAAGG + Intergenic
1180051285 21:45332065-45332087 GCAGAGGCAGGGCTGGAGCAGGG + Intergenic
1181727565 22:24822063-24822085 AGAGATGAACAGGTAGAGCATGG - Intronic
1182097097 22:27633344-27633366 GGAGGTGGACAGCGGGAGCAGGG + Intergenic
1182397542 22:30047076-30047098 AGAGCTCCACAGCTGGATCAAGG - Intergenic
1182991313 22:34770619-34770641 GGAGAAACACAGCTGGTGAAAGG - Intergenic
1183167792 22:36160728-36160750 GCAGATGCACGGCTGGAGGTGGG - Exonic
1183232033 22:36588635-36588657 AGTGATGCACAGCTGGACCCAGG - Intronic
1183384682 22:37508216-37508238 GGAGATGCAGAGCTGGGGAAGGG - Intronic
1184385880 22:44174276-44174298 GGAGAGGGACAGCTGAAGCCTGG + Intronic
1184737964 22:46410216-46410238 GGAGATGCACATCTCCAGCCTGG + Intronic
1184903823 22:47465230-47465252 GGAGAGGCACAAATGGAGCCTGG + Intronic
1185271355 22:49930613-49930635 GGAGATGCACAGCCTGGCCATGG - Intergenic
949981979 3:9507881-9507903 GGTGATGCAGAGCTGGTGGAGGG - Intronic
950208320 3:11096905-11096927 GGAGAGGCTCAGCTGGAGGCAGG - Intergenic
950519061 3:13485442-13485464 GGAGGCGCTCAGCTGGGGCAGGG + Intronic
950565124 3:13764848-13764870 GGAGGGGCACAGCTGGGGCCAGG - Intergenic
950723197 3:14899092-14899114 GGAGATGGCCAGCTGAGGCAGGG - Intronic
952025808 3:29080506-29080528 GAAGATGCACAGCTAGAGGCTGG + Intergenic
952759787 3:36903737-36903759 GGAGGGGCACAGCTGGAAGATGG + Intronic
953635008 3:44655973-44655995 AGAGATGCCCAGCTGGGGTATGG + Intronic
953903136 3:46854534-46854556 GGAGATGCACACTTGGCCCAGGG - Intergenic
954198930 3:49012842-49012864 GAAGGTGCACAGCTTGAGCTGGG + Exonic
954405834 3:50344680-50344702 GGAGATGCCTGGCTGGAACATGG - Intronic
954638650 3:52085223-52085245 GGAGGAGCCCAGCTGGGGCAGGG - Intronic
956822015 3:72962522-72962544 GGAGATAGAAAGCTGGAGAAAGG + Intronic
957435066 3:80164205-80164227 TGAGGTGCACAGCTAGGGCAAGG + Intergenic
957891496 3:86364764-86364786 GGAGAAGAACAGTTGGAACATGG + Intergenic
959056093 3:101569067-101569089 GGAAATGGACAGGCGGAGCACGG + Intergenic
960522525 3:118671774-118671796 TGAGATGCACGGAGGGAGCAGGG - Intergenic
962120966 3:132559473-132559495 GGAGATGGACAGATGGGGAATGG + Intronic
962432033 3:135328840-135328862 GCAGATGCACAGAAGGAGCCTGG + Intergenic
963043753 3:141087674-141087696 GGAGTGGCAGAGCTGGACCAGGG + Intronic
964637865 3:158877480-158877502 GGAGATATGCAGATGGAGCAAGG - Intergenic
966599046 3:181756870-181756892 GGGGGTGAACAGCTGGAGGAGGG + Intergenic
967051773 3:185791589-185791611 TGTGATGCACACCTGGAGGAAGG - Intronic
968575290 4:1363250-1363272 GGAGATGCTCACCGGGACCAGGG + Intronic
969277994 4:6149914-6149936 GGAGAAGCCCAGCTGGAGGGTGG - Intronic
970026602 4:11630614-11630636 TGAGATGCAGAGGTGGGGCAGGG + Intergenic
971468142 4:26987581-26987603 GGAGATTCAGAACTGCAGCATGG - Intronic
971727161 4:30328329-30328351 GATGAGGCATAGCTGGAGCAGGG + Intergenic
973807480 4:54540016-54540038 TGAGGTGCACAGCTGCAGGATGG + Intergenic
981176846 4:141691944-141691966 GGAGAACCTCTGCTGGAGCAGGG - Intronic
986029350 5:3880874-3880896 ACAGAGGCACAGCTGGAGCTCGG + Intergenic
987766710 5:22240995-22241017 GGAGAGGAACAGCTAGAGAATGG + Intronic
990873766 5:60462087-60462109 GGAGAGGCATGGCTGGAGAAGGG - Intronic
991249437 5:64543708-64543730 GGAGCTGCATAAGTGGAGCAGGG + Intronic
993320252 5:86461743-86461765 GGATTTGCATAGCTTGAGCATGG - Intergenic
996318990 5:122192697-122192719 TCAGAGGAACAGCTGGAGCAGGG + Intergenic
996848931 5:127931492-127931514 CAATATGCACAGCTGGAGGAGGG - Intergenic
998493033 5:142563604-142563626 GGAAATGCACATCTTGATCATGG - Intergenic
998852628 5:146365232-146365254 GGAGATGCAGAGCAGGAGATGGG - Intergenic
999106443 5:149075258-149075280 GGAGGTGCACAGCTGTGGCTTGG - Intergenic
999727226 5:154446601-154446623 GGAGATGAACGGCTTCAGCACGG + Exonic
1001066355 5:168537883-168537905 GAAGATGCAGAGCATGAGCAGGG + Intergenic
1001645380 5:173277793-173277815 GAAGTTGCACAGGTTGAGCATGG - Intergenic
1001700659 5:173704532-173704554 GGTGATGCGTAGCCGGAGCAAGG - Intergenic
1001821334 5:174712818-174712840 GGAGAAGGACAGGTGGAGCGGGG - Intergenic
1002602549 5:180362219-180362241 GGGGGTGCCCAGCTGGAGAAAGG - Intergenic
1003264243 6:4551595-4551617 GGAGAGGCAAAGCTGGAGAGGGG - Intergenic
1003747266 6:9016590-9016612 GGAGATGAAAAGTTGGAGCAAGG + Intergenic
1005505481 6:26465625-26465647 GGAAATGCACAGCAGCAGCAAGG + Intronic
1007273372 6:40655618-40655640 AAAGATGCTCAGCTGAAGCAGGG + Intergenic
1007578464 6:42940876-42940898 GGAGATGCAGAGGTGGAGGCTGG - Intergenic
1011770314 6:90668574-90668596 GGAGATGCACAATTGGTTCAAGG - Intergenic
1013176293 6:107680112-107680134 GCAGATCCTGAGCTGGAGCAAGG + Intergenic
1013795594 6:113884925-113884947 GGAGACACACAGCTGCTGCATGG + Intergenic
1016012956 6:139157814-139157836 GGCGAGGCACAGGTGGAGGAGGG + Intronic
1017799627 6:157882024-157882046 GGACTTGCACAGCTGGAGAGGGG + Intronic
1019057052 6:169231529-169231551 GGAGCTGCTCAGCTGGAAGAAGG - Intronic
1019659762 7:2217620-2217642 ACAGTTGCACAGCTGGAGCTGGG - Intronic
1022229934 7:28404925-28404947 AGAATTGCACAGCTGGGGCATGG - Intronic
1026469707 7:70684691-70684713 GGGGATGGACAGTGGGAGCATGG + Intronic
1027237461 7:76306570-76306592 AGAGACCCACATCTGGAGCAGGG + Intergenic
1027772424 7:82424237-82424259 GGACATGCACAGGCTGAGCAGGG + Intronic
1029441100 7:100586939-100586961 GGAGATGCCCAGCTCGAGGAGGG + Intronic
1030709994 7:112738731-112738753 GGAGCTGCAGCACTGGAGCAAGG - Intergenic
1030918017 7:115341070-115341092 GGAGAAGCAGAGCTGGAAGAGGG - Intergenic
1031288305 7:119900454-119900476 AGAGATGCTGTGCTGGAGCAAGG + Intergenic
1032177777 7:129646608-129646630 GAAGAGGCACAGCTGGAGTTGGG + Intronic
1032940576 7:136785160-136785182 GGAGATGCTCACCTTGAGCATGG - Intergenic
1033042900 7:137934497-137934519 TGAGATGCACAGCTGATGAAAGG + Intronic
1033429352 7:141274786-141274808 GCAAAGGCACAGCTGGAGGAGGG + Intronic
1033813569 7:145046173-145046195 GAGAATGCACAGCTGGAGCATGG + Intergenic
1034036580 7:147829987-147830009 GGAGATCCACTTCTGGAGCAAGG - Intronic
1034132715 7:148735324-148735346 GCAGGTGCAGAGCTGCAGCAGGG - Intronic
1034265877 7:149780454-149780476 GGGGTTACACAGCTGGCGCACGG - Intergenic
1034516665 7:151586191-151586213 TGAGATGCAGAGCTGCAGCTTGG - Intronic
1035025598 7:155823181-155823203 TGTGATGCACAGCTAGAGCCTGG + Intergenic
1035216691 7:157372848-157372870 GGAGAAGAACAGCTGGGGAAGGG - Intronic
1035296629 7:157871046-157871068 TGAGCTGCACAGCTGGGGTAGGG + Intronic
1036387056 8:8291789-8291811 GGCGATGCTCAGCCTGAGCATGG - Intergenic
1036490627 8:9221913-9221935 TGAGATCCAGAGCTGGAGTAAGG - Intergenic
1036610134 8:10342622-10342644 TGAGCAGCACAGCTGGGGCAGGG + Intronic
1038017654 8:23529005-23529027 GGAGCTGCGCAGCGGGAGCGTGG + Exonic
1038499133 8:28028898-28028920 GGAGATGCACAGCTGGGATTTGG - Intronic
1039617564 8:38968606-38968628 AGACATGCACAGCTGGATTAAGG + Exonic
1039648515 8:39314587-39314609 GGAGAGGCGCAGCTCGCGCAGGG - Intergenic
1040722567 8:50344320-50344342 AGAGATCTCCAGCTGGAGCAAGG + Intronic
1042011346 8:64248588-64248610 GGAGATGAACAACTGAAGCCTGG - Intergenic
1042784665 8:72535202-72535224 GGAAATGCAGAGCTGGAGCTTGG + Intergenic
1042886262 8:73555251-73555273 GCAGATGGCCAGCAGGAGCAAGG + Intronic
1043345428 8:79292264-79292286 GGAGTGACACAGCTGCAGCAGGG + Intergenic
1043441837 8:80283159-80283181 AGGGATGCACATCTGGAGCCAGG + Intergenic
1043514665 8:80985056-80985078 GCAGCTGCACACCTGGAGAAAGG - Exonic
1045311547 8:101007671-101007693 GGAGATGCCAAGTTGGAGCAGGG + Intergenic
1048439510 8:134449819-134449841 GCAGACACACTGCTGGAGCAAGG + Intergenic
1048494291 8:134922380-134922402 GCAGCTGCACAGCTTGGGCACGG - Intergenic
1048775495 8:137941562-137941584 GGAGTTTCAGAGCTGGAGCTGGG + Intergenic
1049071301 8:140357902-140357924 GGAGCTGCACGGCTGTCGCAGGG + Intronic
1049418918 8:142508276-142508298 GGAGAGGAACAGGTGGAGCAGGG - Intronic
1049497898 8:142945261-142945283 GGAGAGGCACAGCTGGTGGTCGG + Intergenic
1049553654 8:143271943-143271965 GGAGATGCAGATCAGGAGCTGGG + Intronic
1049581204 8:143411870-143411892 GGAGCTGCCCCGCAGGAGCAGGG + Intergenic
1049661427 8:143821273-143821295 GGCTGTGCACAGCTGGGGCAGGG + Intronic
1049730475 8:144175151-144175173 GGAGAAGCTCAGGTGCAGCAGGG - Intronic
1051154511 9:14125706-14125728 GGAGATGCAGAGCTGAACAATGG + Exonic
1056065710 9:82932229-82932251 GGAGGGGCACACCTGGAGTATGG + Intergenic
1056752657 9:89363435-89363457 GATGATGCAGAGCTGGAGGAAGG - Intronic
1056902593 9:90613597-90613619 GGAGATGGACAGCCGCTGCATGG + Exonic
1057820099 9:98323604-98323626 GGAGCTGGACAGCTTGGGCAGGG - Intronic
1058555327 9:106160525-106160547 GAAGAGGAACAGATGGAGCAGGG + Intergenic
1058804650 9:108579040-108579062 GGACAGGTACAGCTGGAGGAGGG + Intergenic
1059529447 9:115022450-115022472 GGAGGAGCAGAGCTGGAGCTGGG + Intronic
1061326477 9:129867703-129867725 GGAGATTCAGAGCCGGAGCCGGG + Intronic
1061883333 9:133578799-133578821 GGGGAGGCACAGCTGGGGCCTGG - Exonic
1062052928 9:134456817-134456839 GGGAAGGCACAGCTGGAGCTCGG - Intergenic
1185467461 X:363253-363275 GGAGATGCACTGCGGGATCATGG - Intronic
1185467468 X:363282-363304 GGAGATGCACTGCGGGATCGTGG - Intronic
1185467526 X:363514-363536 GGAGATGCACTGCGGGATCGCGG - Intronic
1185467533 X:363543-363565 GGAGATGCACTGCGGGATCGCGG - Intronic
1187740990 X:22355362-22355384 GGGGATGCAGCGCTGGAGGAAGG + Intergenic
1188897296 X:35685376-35685398 GGGGATGAATAGGTGGAGCACGG + Intergenic
1188980603 X:36723716-36723738 GGAGATGCACATTTGGAGGAAGG + Intergenic
1190699843 X:52979513-52979535 GGAGAAGGACAGCTGGAGGGAGG - Intronic
1196054130 X:111336620-111336642 GAAGATACACAGCTGGCTCATGG + Intronic
1198551634 X:137751534-137751556 GGAAAGGCAAAGATGGAGCAGGG - Intergenic
1199934093 X:152554080-152554102 GGAGGTGGACAGTTGGAGCCGGG - Intergenic
1199984262 X:152939044-152939066 GGAGGGCCACAGATGGAGCAGGG + Intronic
1200074573 X:153544749-153544771 GGAGAAGCACACTTGGAGAAAGG - Intronic
1200250970 X:154553555-154553577 GGAGAGGCCCTGCTGGAGCATGG + Intronic
1201159932 Y:11158725-11158747 GGACATGCACAGCTGGAATTCGG - Intergenic