ID: 1134237147

View in Genome Browser
Species Human (GRCh38)
Location 16:12475521-12475543
Sequence ACGATATTTTCAACTCACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134237147_1134237148 0 Left 1134237147 16:12475521-12475543 CCATTGTGAGTTGAAAATATCGT No data
Right 1134237148 16:12475544-12475566 AAGTTGAAAATGCATTTAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134237147 Original CRISPR ACGATATTTTCAACTCACAA TGG (reversed) Intronic
No off target data available for this crispr