ID: 1134238464

View in Genome Browser
Species Human (GRCh38)
Location 16:12486294-12486316
Sequence GAAATTAAGGGCCCTGACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134238464_1134238473 19 Left 1134238464 16:12486294-12486316 CCTGTGTCAGGGCCCTTAATTTC No data
Right 1134238473 16:12486336-12486358 CTGTACAGTAGCATATTCACAGG No data
1134238464_1134238474 25 Left 1134238464 16:12486294-12486316 CCTGTGTCAGGGCCCTTAATTTC No data
Right 1134238474 16:12486342-12486364 AGTAGCATATTCACAGGTTCTGG 0: 4
1: 31
2: 112
3: 358
4: 728
1134238464_1134238467 -7 Left 1134238464 16:12486294-12486316 CCTGTGTCAGGGCCCTTAATTTC No data
Right 1134238467 16:12486310-12486332 TAATTTCACCTCCTCTGCAGTGG No data
1134238464_1134238476 27 Left 1134238464 16:12486294-12486316 CCTGTGTCAGGGCCCTTAATTTC No data
Right 1134238476 16:12486344-12486366 TAGCATATTCACAGGTTCTGGGG 0: 8
1: 97
2: 290
3: 604
4: 1209
1134238464_1134238475 26 Left 1134238464 16:12486294-12486316 CCTGTGTCAGGGCCCTTAATTTC No data
Right 1134238475 16:12486343-12486365 GTAGCATATTCACAGGTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134238464 Original CRISPR GAAATTAAGGGCCCTGACAC AGG (reversed) Intronic
No off target data available for this crispr