ID: 1134238465

View in Genome Browser
Species Human (GRCh38)
Location 16:12486306-12486328
Sequence TGCAGAGGAGGTGAAATTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 436
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 401}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134238465_1134238476 15 Left 1134238465 16:12486306-12486328 CCCTTAATTTCACCTCCTCTGCA 0: 1
1: 0
2: 2
3: 32
4: 401
Right 1134238476 16:12486344-12486366 TAGCATATTCACAGGTTCTGGGG 0: 8
1: 97
2: 290
3: 604
4: 1209
1134238465_1134238477 22 Left 1134238465 16:12486306-12486328 CCCTTAATTTCACCTCCTCTGCA 0: 1
1: 0
2: 2
3: 32
4: 401
Right 1134238477 16:12486351-12486373 TTCACAGGTTCTGGGGATTGAGG No data
1134238465_1134238474 13 Left 1134238465 16:12486306-12486328 CCCTTAATTTCACCTCCTCTGCA 0: 1
1: 0
2: 2
3: 32
4: 401
Right 1134238474 16:12486342-12486364 AGTAGCATATTCACAGGTTCTGG 0: 4
1: 31
2: 112
3: 358
4: 728
1134238465_1134238473 7 Left 1134238465 16:12486306-12486328 CCCTTAATTTCACCTCCTCTGCA 0: 1
1: 0
2: 2
3: 32
4: 401
Right 1134238473 16:12486336-12486358 CTGTACAGTAGCATATTCACAGG No data
1134238465_1134238475 14 Left 1134238465 16:12486306-12486328 CCCTTAATTTCACCTCCTCTGCA 0: 1
1: 0
2: 2
3: 32
4: 401
Right 1134238475 16:12486343-12486365 GTAGCATATTCACAGGTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134238465 Original CRISPR TGCAGAGGAGGTGAAATTAA GGG (reversed) Intronic
900715628 1:4141714-4141736 TGCAGATAAGATTAAATTAAGGG + Intergenic
900797074 1:4714429-4714451 TACAGAGGAGGTGACAGTAAGGG - Intronic
900835124 1:4997386-4997408 TCCAGAGTAGCTGAAATTACAGG + Intergenic
900856895 1:5193165-5193187 TGCAGAGTAGCTGGAATTACAGG - Intergenic
902266027 1:15265597-15265619 TTCTGAGGAGCTGAAAGTAATGG + Intronic
902503984 1:16927826-16927848 TGCAGGGGAGGTGGAAGTAGGGG - Intronic
902826895 1:18981016-18981038 TGCAGAGGTGATTAAGTTAAGGG + Intergenic
904168390 1:28573647-28573669 TCCTGAGGAGGTGAGATTATAGG - Intronic
904590601 1:31613374-31613396 TGCAGATGTGGCTAAATTAAGGG - Intergenic
905145037 1:35881750-35881772 TGCAGAGGCTGGGAACTTAAGGG - Intronic
905419514 1:37830739-37830761 TGCAAGGGAGATGAAGTTAATGG - Intronic
905565902 1:38964554-38964576 GGCAGAGGATGACAAATTAAAGG - Intergenic
908568833 1:65387252-65387274 TACTGAGGATGTGGAATTAAGGG + Intronic
910674639 1:89804258-89804280 TGCAGAGGTGGTGAGAGGAACGG - Intronic
912078176 1:105904513-105904535 ACCAGAGGAGGTGAACTCAAGGG - Intergenic
913187158 1:116379356-116379378 TGCAGAGGAGGTGAGCCTGAGGG - Intronic
914717699 1:150265989-150266011 TGCCCTGGAGATGAAATTAATGG - Exonic
915140738 1:153766811-153766833 TGCTGAGTAGCTGAAATTACAGG + Intronic
916861977 1:168815883-168815905 TGAAGAGGAGGAAAAATGAAAGG - Intergenic
918118982 1:181521247-181521269 TGGAGAGGAGGTGAGATGCAGGG - Intronic
918420078 1:184355226-184355248 TACACAGGAGGTGAAAGTAATGG - Intergenic
918695915 1:187546066-187546088 TCCAGAGTAGGTGAGATTACAGG - Intergenic
919722246 1:200850639-200850661 TGCAGAGGAAGGGAAACAAAGGG + Intronic
921240685 1:213178415-213178437 TCCAGAGGAGCTGAGATTACAGG - Intronic
921411698 1:214842880-214842902 TGAAAAGGAGGTGAAATAATGGG - Intergenic
922152161 1:223015959-223015981 TCCAGAGTAGCTGAAATTAAAGG + Intergenic
922273975 1:224059389-224059411 TGCAGATGTGATTAAATTAAGGG + Intergenic
922827035 1:228529079-228529101 GGCAGGGTAGGTGAAATTAGGGG + Intergenic
1064600899 10:16991498-16991520 TGCAGAAGAGGTAAAATTTGAGG + Intronic
1064650306 10:17502287-17502309 TGCAGATGAGGTGAAGTAAGTGG - Intergenic
1064737474 10:18397339-18397361 TCCAGAGTAGCTGAAATTACAGG - Intronic
1064833397 10:19496818-19496840 AGAAGAGGATGTGAAATTGAAGG + Intronic
1064995972 10:21296943-21296965 TCCAGAGTAGCTGAAATTACAGG + Intergenic
1065063186 10:21930097-21930119 TCCAGAGGAGCTGGAATTATAGG + Intronic
1066739943 10:38510761-38510783 TGGAATGGAAGTGAAATTAATGG + Intergenic
1068079232 10:52299113-52299135 TGCAGAAGAAATGAAATTACTGG - Intergenic
1069468635 10:68665394-68665416 TGCAGAGGAGTATAAATTCATGG - Intronic
1069679732 10:70275403-70275425 GGGAGAGGAGGGGAAAGTAAAGG + Intronic
1069713411 10:70505478-70505500 TTCCGAGTAGGTGAAATTATAGG - Intronic
1072212262 10:93257292-93257314 TTCAGAGTAGCTGAAATTACAGG - Intergenic
1072258007 10:93639218-93639240 TGGACAGGTGGGGAAATTAAAGG - Intronic
1072277334 10:93836025-93836047 TACAGAGAAGGTGAAATTTTGGG - Intergenic
1072319312 10:94233303-94233325 TACAGAAGAGGTGAAAACAATGG + Intronic
1072428069 10:95347159-95347181 TGAAGAGAATGTGAAATCAAAGG - Intronic
1073097913 10:100991348-100991370 TCCAGAGGAGGTGACAACAAAGG + Intronic
1073570356 10:104576142-104576164 TGCAGTGAATGTGAAATCAAAGG + Intergenic
1073672690 10:105609724-105609746 TGTAGCAGAGGGGAAATTAAGGG + Intergenic
1073815480 10:107201749-107201771 TGCTGGGGAGGTGAAAATATAGG + Intergenic
1073981481 10:109159026-109159048 TGCAGAGGTTCTGAAATTACAGG - Intergenic
1074599792 10:114901797-114901819 TGCAGATGTGGCTAAATTAAGGG - Intergenic
1075396683 10:122132836-122132858 TGCAGAGGGGGTGAAACTGCAGG - Intronic
1075825906 10:125356854-125356876 TCCTGAGAAGGTGACATTAAAGG - Intergenic
1075912051 10:126133115-126133137 TGCAGGGGAGGTGATATCAGTGG - Intronic
1076625765 10:131820849-131820871 TGCAGAGGCGATTAAATTGAGGG + Intergenic
1078389726 11:10926491-10926513 TCTAGAGGAGGTGATATTATAGG + Intergenic
1080980108 11:37392199-37392221 TGTAGATGAGGTTAAATAAAAGG - Intergenic
1083168927 11:60910532-60910554 TCCAGAGGAAGTGACATTTAAGG - Intergenic
1085849680 11:80105507-80105529 TCCAGAGGATGTAAAAATAATGG - Intergenic
1086190702 11:84075141-84075163 TTCTGAGGAGGTGATATTTAAGG - Intronic
1087514928 11:99146499-99146521 TGCTAAGGAGGAGAAAATAAAGG + Intronic
1088981668 11:114870162-114870184 GTGAGAGGAGGTGAGATTAAGGG + Intergenic
1089511680 11:119002460-119002482 TCCAGAGTAGGTGGAATTACAGG + Intronic
1089547319 11:119238705-119238727 TCCAGAGTAGCTGAAATTAGAGG - Intronic
1089696153 11:120217453-120217475 TCCAGAGTAGCTGAAATTATAGG - Intronic
1089875709 11:121719847-121719869 TTCAGAGGAGGAGAAGTAAATGG - Intergenic
1090134553 11:124183679-124183701 TCCAGAGTAGCTGAAATTATAGG + Intergenic
1090345654 11:126067945-126067967 TTCAGAGGAGTTGAAAGAAAAGG + Intergenic
1090732906 11:129587160-129587182 TGAAGAGGAGGTGAATTTGGAGG - Intergenic
1091179723 11:133593030-133593052 TGAGGAGGAGGGGAAAATAAGGG - Intergenic
1091206820 11:133827185-133827207 TGCTGAGGAGGTGACATTTGGGG - Intergenic
1091639164 12:2221392-2221414 AGCAGTGGAGGTGAGATGAATGG + Intronic
1093043714 12:14416707-14416729 TGCAAAGGATGTGAAAATCAAGG - Intronic
1093094967 12:14961357-14961379 TGCAGAGAAGGGGAAGTTAGAGG - Intronic
1093716697 12:22390960-22390982 TCCAGAGGAGGTTAATTCAAAGG - Intronic
1094260043 12:28484712-28484734 TGAAGAGTAGCTGAAACTAATGG + Intronic
1094686960 12:32727111-32727133 TTCAGAGGAGTTGAAAGAAAAGG - Intronic
1095123476 12:38445820-38445842 TGCAGAGGAGGAAAAATTAGTGG - Intergenic
1097327135 12:58289507-58289529 TGAAGTGAAGGTGAAATTAGAGG + Intergenic
1098102263 12:67030342-67030364 TGCACAGGAGGTAAATTTTAAGG + Intergenic
1098619178 12:72570813-72570835 TGCACAGGCGGTGATATGAATGG + Intronic
1099007879 12:77256524-77256546 TGCAGTTGAGTTGGAATTAAGGG + Intergenic
1100102863 12:91130591-91130613 GGCAGGGGAGGTCGAATTAAAGG - Intergenic
1100284855 12:93155633-93155655 TTCAGAGCAGGTGAAATTGAAGG + Intergenic
1100899303 12:99220121-99220143 TCCAGAGTAGCTGAGATTAAAGG + Intronic
1101897559 12:108767977-108767999 TGCAGAGTAGCTGGAATTACAGG + Intergenic
1103027477 12:117585244-117585266 TGGAGAGGTGGTGATAATAAGGG - Intronic
1103205530 12:119125795-119125817 TCCAGAGTAGCTGGAATTAAAGG - Intronic
1104775190 12:131386603-131386625 TGCATTTGAGGGGAAATTAAAGG + Intergenic
1105492280 13:20900733-20900755 TCCAGAGTAGCTGAGATTAAAGG + Intronic
1105604161 13:21913137-21913159 CCCAGAGGAAGTGAAATAAAAGG - Intergenic
1105685608 13:22778052-22778074 TGCAGAGAAGGTAAATTTAAGGG + Intergenic
1105910999 13:24867282-24867304 TGCAGAGTAGCTGGAACTAAAGG + Intronic
1106206040 13:27595596-27595618 TGATGAGGAAGTGAAATTAGAGG - Intronic
1106726811 13:32494897-32494919 TGCAGAGGAGGTGGGAGCAAAGG - Intronic
1107350642 13:39510994-39511016 TCCCGAGTAGGTGAAATTACAGG + Intronic
1107565894 13:41604085-41604107 TTCAGAGGAGGTGAGAGTAATGG - Intronic
1109874091 13:68375735-68375757 TGCAAAGGCGGTGGAATCAAGGG - Intergenic
1111498602 13:89087509-89087531 TGCACAGGATGTGAAATATATGG + Intergenic
1113100754 13:106714819-106714841 TGGAGGGGAGCTGAAATGAAAGG + Intergenic
1114620457 14:24093553-24093575 TGCAGAGTAGCTGGAATTACAGG - Intronic
1114696660 14:24632549-24632571 TGCAGCTGAGGGGAAATTAAGGG + Intronic
1115444548 14:33474494-33474516 CGGAGAGGAGGTAAAATTACAGG + Intronic
1116160795 14:41264779-41264801 TGCAGAGAAGGTTTAATTACGGG - Intergenic
1116239623 14:42324179-42324201 TGAAGAGGAGGTGTAAGTATAGG + Intergenic
1117651820 14:57915383-57915405 TGCTTAGGAGGGAAAATTAAGGG - Intronic
1118091437 14:62484682-62484704 TGCAGAGGAGGGGAAGCTGAAGG - Intergenic
1119119824 14:72064275-72064297 TGGAGAGGAGGTCAAGTCAATGG + Intronic
1119494534 14:75067564-75067586 TGGAGAAGAGGAGAAATGAATGG + Intronic
1121458399 14:94054365-94054387 TACAGAGGAGGTGGAATTCCAGG - Intronic
1121612711 14:95292634-95292656 TGCAGAGCAGGTGAAGTCAGAGG - Intronic
1122734132 14:103825966-103825988 TCCAGAGTAGCTGAAATTACAGG + Intronic
1124324471 15:28746123-28746145 TGCAAAAGAGCTGAAATTCAGGG + Intergenic
1124564108 15:30799229-30799251 TCCAGAGTAGGTGGAATTACAGG - Intergenic
1126063304 15:44804760-44804782 TTGAGAGGATGTGAAATTGAGGG + Intergenic
1127977513 15:64009059-64009081 TGCACAGGAGGTGAAAATAGAGG - Intronic
1128367007 15:67011462-67011484 TACAGAGGAGGGGACACTAAGGG + Intergenic
1131040715 15:89263918-89263940 TGCAGAAGAGGTGGAATTTGTGG + Exonic
1131384857 15:91996425-91996447 TGCAATGGAAGTGAAATTACAGG - Intronic
1131696329 15:94881424-94881446 TGCAGAGGAGGGGAAGGTGACGG + Intergenic
1134238465 16:12486306-12486328 TGCAGAGGAGGTGAAATTAAGGG - Intronic
1134600558 16:15530374-15530396 TGCAGATGTGATTAAATTAAGGG - Intronic
1135035175 16:19071257-19071279 TCCCGAGGAGGTGGGATTAAAGG + Intronic
1135465166 16:22678682-22678704 GGCAGAGGAGAAGAAATTAGTGG + Intergenic
1136341723 16:29648409-29648431 TCCAGAGCAGCTGAAATTACAGG + Intergenic
1137009398 16:35308497-35308519 TGCAGAGGAGGAAAAATGAGGGG - Intergenic
1138191349 16:55016584-55016606 TGCATGGGAGCTGAAATAAATGG + Intergenic
1139202153 16:64988859-64988881 TGCGAAGGAGGTGAAATAAGGGG - Intronic
1139610790 16:68056298-68056320 AGCAAAGAAGGTGAAATTAAAGG - Intronic
1139784116 16:69377077-69377099 TCCTGAGGAGCTGAAATTACAGG - Intronic
1140876423 16:79156833-79156855 TGTAGAGAAGATGAAATAAAAGG - Intronic
1141486258 16:84342266-84342288 TGCAGATGGGATGAAGTTAAAGG - Intergenic
1141858959 16:86703768-86703790 TGCAGAGGAGGAGTTATGAAAGG + Intergenic
1142710256 17:1719167-1719189 TGTAGATGAGGGGAAATTATCGG - Intronic
1143820811 17:9560710-9560732 TGCAGAAGAGGTGATAATTAAGG + Intronic
1143853678 17:9832437-9832459 TCCTGAGTAGGTGAAATTACAGG - Intronic
1144271873 17:13625439-13625461 GACAGAAGACGTGAAATTAAGGG + Intergenic
1144473499 17:15564301-15564323 AACAAAGGATGTGAAATTAAGGG + Intergenic
1144923024 17:18780509-18780531 AACAAAGGATGTGAAATTAAGGG - Intergenic
1145813578 17:27780121-27780143 CTCAGAGGAGGTGACATTATAGG + Intronic
1146292534 17:31620564-31620586 TGCTGAGTAGCTGAAATTACAGG + Intergenic
1147281568 17:39365919-39365941 TACAGATGAAGTGAAACTAAGGG - Intronic
1147352662 17:39863835-39863857 TGCAGAGGAAGAGCACTTAAGGG - Intronic
1147722214 17:42546407-42546429 TGCAGAGGCTGTGAAAGTAAAGG - Intergenic
1147723398 17:42552577-42552599 TGCAGAGGCTGTGAAAGTAAAGG - Exonic
1148748966 17:49933827-49933849 TCCAGAGTAGCTGAAATTACAGG - Intergenic
1148880775 17:50724883-50724905 TCCAGAGTAGGTGGAATTACAGG + Intronic
1150287304 17:63961593-63961615 TACAGGGGAGGTGACAGTAAGGG - Intronic
1154018295 18:10639317-10639339 TGCACTGGAAGAGAAATTAATGG + Intergenic
1154186576 18:12190273-12190295 TGCACTGGAAGAGAAATTAATGG - Intergenic
1154993755 18:21620419-21620441 TGCAGAGGATGAAAAGTTAAAGG - Intronic
1155016939 18:21852528-21852550 TGAAGAAGAGGTGAAAGTGAGGG + Intronic
1155079889 18:22398388-22398410 TGCACAGGAGGTTAAATTTAAGG + Intergenic
1155236892 18:23829271-23829293 TTCAGATGAGGTGAATTTTATGG - Intronic
1155471830 18:26199756-26199778 TCCAGAGGAAGTGCAATCAATGG - Intergenic
1156171521 18:34492799-34492821 TGCAGAGGAGGTGGATGAAAAGG - Intergenic
1156254544 18:35382548-35382570 TGCAGATGTGTTTAAATTAAGGG - Intergenic
1156317732 18:35986434-35986456 TCCAGAGTAGCTGGAATTAATGG - Intronic
1156337304 18:36183248-36183270 TGCAGAAGTGATGAAATTCAGGG - Intergenic
1157152337 18:45230581-45230603 TGCAGATGTGATTAAATTAAGGG - Intronic
1157162574 18:45327526-45327548 TGCAGAGGAGAAGAGATTGAGGG - Intronic
1158011328 18:52731412-52731434 TTCAGAGGTGGTGTAGTTAATGG + Intronic
1158300433 18:56046283-56046305 TGCAGAGGTGGTGAGAAGAAGGG - Intergenic
1158417258 18:57259572-57259594 TGCAGAAGATGCGGAATTAAAGG + Intergenic
1158821335 18:61162529-61162551 GGCAGAGGTGGAGAAATTGATGG - Intergenic
1159637773 18:70826283-70826305 TGTAGAGGAGGTGATATCTAAGG - Intergenic
1162021908 19:7871949-7871971 TGCAGAGGGGATGAAACTGATGG + Exonic
1162153620 19:8662357-8662379 TGCTGAGGAGGTGACATTGGAGG + Intergenic
1162436814 19:10665559-10665581 TCCTGAGTAGCTGAAATTAACGG + Intronic
1165569367 19:36762449-36762471 TGCAGCGCTGTTGAAATTAAAGG + Intronic
1165893335 19:39127561-39127583 TGCAGAGGATGTGACATTGCTGG + Intronic
1166342254 19:42145442-42145464 TTCAGAGGAGTTTAACTTAACGG + Intronic
1166649150 19:44557528-44557550 TTCTGAGGAGGTGAAATTACAGG - Intergenic
1167776267 19:51559609-51559631 TGTAGAGGAGGTGCAAGGAAAGG + Intergenic
1167885223 19:52494371-52494393 TACAGAGTAGCTGAAATTACAGG - Intronic
1167889894 19:52530847-52530869 TCCGGAGTAGGTGAAATTAGAGG - Intronic
1167913585 19:52722852-52722874 TACAGAGTAGCTGAAATTACAGG + Intronic
1167914694 19:52731188-52731210 TCCAGAGTAGCTGAAATTAGAGG + Intronic
925235856 2:2276711-2276733 TGCAGAGAGGGTGAGATTCAAGG - Intronic
925617112 2:5754189-5754211 TACTGAGGAAGAGAAATTAAGGG + Intergenic
926564646 2:14455859-14455881 TGCAGAGAAGGTGTAAGTATAGG - Intergenic
926619063 2:15030645-15030667 TTCAGAGGTGGAGAAATTCAGGG - Intergenic
928393588 2:30927625-30927647 TGCAGAAGCAGTGAAGTTAATGG + Intronic
928644541 2:33338503-33338525 TGCTGATGAGGTTAAGTTAAAGG + Intronic
928967792 2:36994622-36994644 TTCATATGAGGTGAATTTAAAGG - Intronic
928980771 2:37133345-37133367 TGCAGAAGAGGAGAAATGAGAGG - Intronic
929383286 2:41378502-41378524 AGCAAAGGAAATGAAATTAAGGG - Intergenic
929391473 2:41473290-41473312 TGCAGAGAAGGTTTGATTAATGG + Intergenic
929403410 2:41611933-41611955 TGCAGAGGAATTGAAGTGAATGG - Intergenic
930119188 2:47746153-47746175 TGCAGAGGAGCTGCAATTACAGG - Intronic
930610763 2:53540527-53540549 AGCAGAGGAGCTGAAAAGAAGGG + Intronic
930733960 2:54756185-54756207 GGCAGAGTGGGTGAAATTTAGGG + Intronic
930777192 2:55184779-55184801 TCCTGAGTAGGTGAGATTAAAGG - Intronic
931139730 2:59444446-59444468 TGCAGTGGGGTTGAAATAAAGGG - Intergenic
931215069 2:60234466-60234488 TGCAGAGGAGGTGCCATTTGAGG + Intergenic
931777984 2:65556392-65556414 TGGAGTGGAGGTGAAAGTCATGG + Intergenic
932084357 2:68745187-68745209 TGCAAAGGAGGTGGAACTACCGG - Intronic
932180905 2:69644685-69644707 AGCAAAGGAGGAGGAATTAAGGG - Intronic
932533758 2:72568716-72568738 TACAGAAGAGGTAAAATTGAGGG + Intronic
932738846 2:74276175-74276197 GGGAGAGGAGGGGAAATAAAAGG + Intronic
934118751 2:88820138-88820160 TACAGAGGAGGAAATATTAATGG - Intergenic
935588955 2:104827462-104827484 TGCAGAGTAGCTGGGATTAAAGG - Intergenic
936162189 2:110092354-110092376 TACAGAGGAGGAAATATTAATGG - Intronic
936182473 2:110279000-110279022 TACAGAGGAGGAAATATTAATGG + Intergenic
936537680 2:113324708-113324730 AGCAGAGAAGGGGAAATAAAAGG - Intergenic
939720138 2:145639085-145639107 TGCAGAGGATGTGAGAAAAAGGG + Intergenic
940725564 2:157332136-157332158 TGCTGAGTAGCTGAAATTACAGG + Intergenic
941324222 2:164093156-164093178 TTCAGATAAGGTGAAATTACGGG + Intergenic
941985716 2:171509647-171509669 TCCAGAGGAGGTGAAATTCAAGG - Intergenic
941991895 2:171565275-171565297 TACGGAGTAGGTGAAATTAAAGG - Intergenic
942127615 2:172842922-172842944 TGCAGAGGTGGTGCAGTTACAGG + Intronic
943813878 2:192226387-192226409 TACAGAGAAGGTGAATTTGAAGG + Intergenic
944933443 2:204544402-204544424 TGCAGAGGAGATTAAATTCATGG - Intergenic
945728657 2:213505160-213505182 TGCAGTCCAGGTGAAATTAAAGG - Intronic
946459283 2:219854707-219854729 TGCTGAGGAGTTTAAATTAAAGG - Intergenic
946800684 2:223413162-223413184 TGCAGCTGAGGTGAAAATGAGGG + Intergenic
947054628 2:226086335-226086357 GCCAGAGGGTGTGAAATTAATGG - Intergenic
948370082 2:237483328-237483350 TGCCCAGGCAGTGAAATTAAAGG + Intergenic
1169179754 20:3553164-3553186 AGAAGAGAAGGTAAAATTAAAGG + Intronic
1170687567 20:18583273-18583295 TGCTGAGTAGCTGAAATTACAGG - Intronic
1170932742 20:20783458-20783480 TGCAGAGGATGAGAAATCAGAGG - Intergenic
1171523485 20:25792935-25792957 TGCAGAGGAGGTGGCATCAGGGG - Intronic
1171553341 20:26062948-26062970 TGCAGAGGAGGTGGCATCAGGGG + Intergenic
1171723885 20:28596639-28596661 TCCAGAGGAGCTGGAATTACAGG - Intergenic
1171940456 20:31323903-31323925 TGGAGAGGGGGTGAAATTTATGG - Intergenic
1172255397 20:33513206-33513228 TGGAGAGGATGTGTAATAAATGG - Intronic
1172392134 20:34572953-34572975 TGCAGAGGAGTAGAAAATGATGG + Intronic
1175287024 20:57843889-57843911 GGCAGTGGAGGTGAAAGAAAAGG + Intergenic
1175631194 20:60537683-60537705 TCCCGAGGAGGTGGAATTACAGG - Intergenic
1176752947 21:10705135-10705157 TGGAGAGGAGTGGAATTTAATGG - Intergenic
1177335114 21:19714373-19714395 TGCATCATAGGTGAAATTAAAGG - Intergenic
1178258130 21:31074101-31074123 TGCAGATGAGATTAAGTTAAGGG - Intergenic
1178503718 21:33146499-33146521 TGCAGAGCAGGGGATATTGATGG - Intergenic
1178549896 21:33527956-33527978 TGCACAGGAAGGGAAATCAACGG + Intronic
1178916331 21:36707535-36707557 AGCCCAGGAGGAGAAATTAAAGG + Intronic
1179278243 21:39911153-39911175 GGCAGTGGAGGGGAAAGTAAGGG + Intronic
1181612018 22:24021556-24021578 TCCTGAGTAGGTGAAATTACAGG + Intronic
1182680180 22:32073511-32073533 AGCAGAGGAGGAGAAAGTAAAGG - Intronic
1183744990 22:39686913-39686935 TGGAGAAGAGGTGCAATTCAGGG + Exonic
1183925303 22:41201699-41201721 AGCAGAAGAGGTGAGTTTAAGGG - Intergenic
1185161133 22:49230445-49230467 TGCTGAAGAGGTGAATGTAATGG - Intergenic
1203300667 22_KI270736v1_random:74839-74861 TGGAGAGGAGTGGAAATGAATGG + Intergenic
1203305461 22_KI270736v1_random:105978-106000 TGGAGTGGAGTTGAAAGTAATGG + Intergenic
1203308417 22_KI270736v1_random:125572-125594 TGCAGTGGAGTGGAAATGAATGG + Intergenic
949394608 3:3601558-3601580 TGCAGAAGAAGGGAAGTTAAAGG + Intergenic
950188638 3:10960949-10960971 TCCTGAGGAGGAGAAATCAATGG - Intergenic
950477592 3:13223703-13223725 TGCAGAGGAAGTCAAAGCAAAGG + Intergenic
950720832 3:14881508-14881530 CCCTGAGGAGGTGATATTAAGGG + Intronic
951400836 3:22229964-22229986 TGCAGAGAAGGTGTAAGTATAGG - Intronic
951587133 3:24226972-24226994 TCCAGAGGAGCTGGAATGAATGG + Intronic
952435913 3:33272365-33272387 ACCTGAGGAGGTAAAATTAAGGG + Intergenic
952850462 3:37724217-37724239 AGCAGAGAGGGTGAAATGAATGG - Intronic
953329675 3:42042493-42042515 TCCAGAGTAGCTGAAATTACAGG + Intronic
953612312 3:44457393-44457415 TCCAGAGGAGGTGAGACTACAGG + Intronic
954850200 3:53593648-53593670 TGCAGGAGAGGTGAAAGGAAAGG + Intronic
954910060 3:54097170-54097192 TCCAGAGGAGGTGGGATTACAGG + Intergenic
956120870 3:65964643-65964665 TGGAGAGGAGTGGAAGTTAAGGG - Intronic
956203903 3:66736576-66736598 TGCAGAGCAGCTAAAGTTAAGGG - Intergenic
956734639 3:72228721-72228743 TGCAGAGGAGCTAGAATCAAAGG + Intergenic
956979680 3:74621212-74621234 TCCAGAGTAGCTGAAATTATAGG - Intergenic
956992669 3:74786072-74786094 TGCAGAAAAGGTGAAAATATTGG + Intergenic
957407906 3:79795722-79795744 TTCTGAGGAGGTGACATTTAAGG + Intergenic
957635843 3:82783473-82783495 AGGAGAGGTGGTGAAATTGACGG + Intergenic
958617980 3:96520590-96520612 TGCTGAGGAGGTGGAGTAAAGGG + Intergenic
959421342 3:106133448-106133470 TGCAGAGGAAGAGAACATAAAGG + Intergenic
959712350 3:109397632-109397654 TGCAGAGTAGGTAAAGTGAAAGG + Intergenic
960826391 3:121789537-121789559 TGGAGATGAAGTGAAATAAAGGG + Intronic
961082871 3:124041558-124041580 TGCAGAGGAGGAGAAAAAAGGGG - Intergenic
961786986 3:129353284-129353306 TGCAGAGGAAGTCAAAGCAAAGG - Intergenic
962548405 3:136461763-136461785 TGCAGAGTGGGTGAAAATATCGG + Intronic
963078477 3:141369481-141369503 TCCAGAGGTCGTGAAATTATAGG - Intronic
963112044 3:141696037-141696059 TGGAAAGGAACTGAAATTAAGGG + Intergenic
963158302 3:142123083-142123105 TGCTGAGTAGCTGAAATTACAGG + Intronic
963639729 3:147843821-147843843 TGCAGATGTGATTAAATTAAGGG + Intergenic
967413562 3:189192448-189192470 TGAAGAGGATGTGAAAGTTAAGG + Intronic
967870354 3:194224234-194224256 TGCAGAGGAGGTGGAGGTAGGGG - Intergenic
968056792 3:195697858-195697880 GGAGGAGGAGATGAAATTAAGGG - Intergenic
968424948 4:517054-517076 GGCAGAGGAGATGGCATTAAGGG + Intronic
968932014 4:3585962-3585984 CACAGAGGACGAGAAATTAAAGG - Intronic
969696865 4:8739982-8740004 TGCACCTGAGCTGAAATTAATGG + Intergenic
969920062 4:10530033-10530055 GGCAGAGAAGGTGAAAGAAAGGG - Intronic
971031957 4:22648027-22648049 TGCAGAGTAGCTGGAATTACAGG + Intergenic
971219872 4:24695135-24695157 GGCAGAGGAGGTGAAACTGGAGG + Intergenic
973020130 4:45193981-45194003 TACAGAGGAGTGGAAATTACTGG + Intergenic
973058787 4:45692985-45693007 TGCAGAGGAAATGAAAATTAAGG - Intergenic
973865930 4:55112848-55112870 TGCAGAGGAGGGAAAGTTAGGGG + Intronic
976370620 4:84284591-84284613 TGGAGAGGAGTTGAAAATCATGG - Intergenic
976389001 4:84490597-84490619 GGCAGAGGAGGTGTGAGTAAAGG + Intergenic
976426395 4:84908013-84908035 TGCAGAGGATGACAAATGAAGGG + Intronic
976920326 4:90433074-90433096 TGCAGTGCAGGGGAAATTTATGG - Intronic
977036997 4:91966461-91966483 TGCAAAGGAGGGGGAATAAAAGG + Intergenic
977263263 4:94823522-94823544 AGCAGAGGAGAAGGAATTAATGG + Intronic
977910723 4:102532503-102532525 TCCAGAGGAGCTGGAATTACAGG - Intronic
977936252 4:102808594-102808616 TGCTGAGTAGGATAAATTAATGG - Intronic
978448003 4:108799459-108799481 TGCAGTGGAGATGAAAAGAATGG + Intergenic
979957969 4:126979051-126979073 TGCAGAGGAGGAGGAAGTAATGG + Intergenic
980047166 4:128002149-128002171 TGCAGAGTAGCTGAGATTACAGG - Intronic
980161787 4:129172972-129172994 AGGAGAGAAGGAGAAATTAAAGG + Intergenic
982322756 4:154096791-154096813 TGGAGAAGAGGTGGAGTTAAAGG + Intergenic
983195843 4:164805903-164805925 TTCAGTGGATGGGAAATTAATGG - Intergenic
983768734 4:171520653-171520675 TGCAGAGAAGGAAAACTTAAGGG + Intergenic
984396935 4:179213851-179213873 TGCAAAGGTGGTGAAATTTGGGG + Intergenic
985248094 4:187996708-187996730 GGCAGAGGAGATGAAATGCAGGG - Intronic
985980436 5:3457905-3457927 AGCAAAGGAAGTGAAATCAAGGG + Intergenic
986489868 5:8278434-8278456 TGCAGTGGAGGTGATAGTCAAGG - Intergenic
986516257 5:8566960-8566982 TGCAGAGGCTGGGTAATTAATGG - Intergenic
987217601 5:15753738-15753760 TGCAGGGGAAGTAAAAATAATGG + Intronic
987569796 5:19641904-19641926 TGCAGAGGACCTGAAAATAAAGG - Intronic
988563943 5:32305551-32305573 TGCAGAAAAGATGAAATTATTGG - Intronic
988597555 5:32608881-32608903 TGCAAAGTAGGTGAGATTACAGG + Intergenic
988792460 5:34621179-34621201 TCCAGAGTAGCTGAAATTACAGG + Intergenic
988879031 5:35480275-35480297 TATAGTGAAGGTGAAATTAAAGG - Intergenic
991197531 5:63953892-63953914 TGCAGAGAAGGAGCAATTTATGG - Intergenic
991692932 5:69242919-69242941 TGCAGAGTAGCTGGAATTACAGG - Intronic
992179255 5:74180936-74180958 TGCAGTGGAGGTGAGAGGAAAGG + Intergenic
992564244 5:77982094-77982116 TGCAGATGTGATTAAATTAAGGG - Intergenic
992838676 5:80666181-80666203 TGCAGATGAGGTGAGACTAAAGG + Intronic
994891214 5:105639371-105639393 TGCAGGGGAGGGGAATTTACTGG - Intergenic
996543823 5:124656918-124656940 TGCAGGGGAGGTGACAGTGATGG - Intronic
997122050 5:131184786-131184808 GGCAGAGAAGGAGAAAATAATGG - Intronic
997173851 5:131753528-131753550 TGTAGAAGAGGTAAAACTAATGG + Intronic
997513689 5:134470009-134470031 TCCAGAGTAGGTGAGATTACAGG - Intergenic
998999876 5:147908759-147908781 TTCAGAGGAGGTGAAGTCAAAGG - Intergenic
999743760 5:154576442-154576464 TGCAGAGGAGCTTACATTAGGGG - Intergenic
1000127954 5:158265738-158265760 TGTTGAGGAGCTGAAAATAATGG + Intergenic
1000180267 5:158802549-158802571 TACAGTGGAGGTGAAAATACTGG + Intronic
1001385818 5:171337680-171337702 AGCACTGGAGTTGAAATTAATGG - Intergenic
1003134917 6:3427629-3427651 TGCTGAGGAGGTCAAAGTGAAGG - Intronic
1004230714 6:13830702-13830724 TGCTGAAGAGGTCAAATCAATGG + Intergenic
1004791247 6:19028884-19028906 TCGAGAGGAGGTGGAATTGAGGG + Intergenic
1004857144 6:19762767-19762789 TCCAGAGTAGGTGAAACTACAGG + Intergenic
1005969284 6:30748847-30748869 GGCAGAGGAGGGGAAATGAAGGG + Intergenic
1007229850 6:40340572-40340594 TGGAGAGCAGGTGAAGTGAAAGG - Intergenic
1007291679 6:40791968-40791990 TGCAGATGTGATTAAATTAAGGG + Intergenic
1007885480 6:45224652-45224674 TCCAGAGTAGCTGAAATTACAGG - Intronic
1008166323 6:48142976-48142998 TCCAGAGGAGCTGAAACTACAGG - Intergenic
1008523422 6:52384005-52384027 TGCAGGGGAAGTGAAAAAAAGGG + Intronic
1008918453 6:56816396-56816418 TGCAGAAGAGGGCATATTAAAGG - Intronic
1009972352 6:70637985-70638007 TCCAGAGTAGGTGGGATTAAAGG + Intergenic
1010034469 6:71308055-71308077 CGCAGAGTAGGTGGAATTCATGG - Exonic
1010085918 6:71917950-71917972 TGGAGAGGAGGTCCAATTGATGG + Intronic
1011007389 6:82661964-82661986 GGCAGATGAGTTAAAATTAAAGG + Intergenic
1011782238 6:90802428-90802450 TGAAGAGGAGATGCACTTAAAGG - Intergenic
1012423227 6:99087268-99087290 TGCTGAGGATGCAAAATTAAAGG - Intergenic
1012546760 6:100428550-100428572 TGAAGATAAGGTGAAATGAATGG + Intronic
1012977175 6:105793121-105793143 TGCAGAGGAGGAAAAATTGCTGG + Intergenic
1013704130 6:112812871-112812893 TGCAGAGAAAGTGCAAATAAAGG - Intergenic
1013724180 6:113072083-113072105 TCCAGAGTAGCTGAAATTACAGG - Intergenic
1014140361 6:117934981-117935003 TTCAGAGGAGCTGGGATTAAAGG - Intronic
1014151967 6:118067679-118067701 TCAAGAGCAGGTGCAATTAATGG + Intronic
1014163835 6:118201160-118201182 GGCAGAGGGGGTGAAATGCATGG + Intronic
1015579981 6:134713773-134713795 CACAGAGGAGGTAAAATTAAAGG + Intergenic
1015926833 6:138319212-138319234 TGCAGAGTAGGTGAGATTACAGG + Intronic
1016033882 6:139365442-139365464 TTCAGAGGAGGAGAAATGATAGG + Intergenic
1016065110 6:139673978-139674000 TGCAGAGGAGGTGGAGAAAAGGG + Intergenic
1016474214 6:144408815-144408837 TGTACAGGAGGTGCAATAAAAGG + Intronic
1017625462 6:156343135-156343157 TGCAGATAAAGGGAAATTAAGGG - Intergenic
1018395985 6:163378387-163378409 TGCAGACGTAATGAAATTAAGGG + Intergenic
1019262332 7:88510-88532 TGCAGATGTGGATAAATTAAGGG - Intergenic
1019808280 7:3145056-3145078 TCCAGAGTAGCTGAAATTACAGG - Intronic
1019926892 7:4198935-4198957 TCCAGAGTAGCTGAAATTACAGG + Intronic
1020517978 7:9149029-9149051 TCCAGAGGAGGGGAAAGTTAAGG + Intergenic
1021085775 7:16420387-16420409 AGCTGAGGAAGTGAAATGAAGGG - Intronic
1021291685 7:18852821-18852843 TGCTGAGGAGATCAAAGTAAAGG + Intronic
1021421926 7:20455262-20455284 TGCTGAGAAGGGGAAAATAAAGG - Intergenic
1022324571 7:29319516-29319538 TCCACAGGATGTTAAATTAAAGG - Intronic
1022509110 7:30923874-30923896 TGTGGAGGAGGTGAAAGAAAGGG + Exonic
1022985188 7:35647072-35647094 TACAGAGGAGAAGAGATTAAAGG + Intronic
1023238495 7:38116329-38116351 TGCACTGGAGGTGAAAATAGTGG + Intergenic
1023278635 7:38547109-38547131 TGGAGAGGAGATGCAATTATTGG - Intronic
1023495659 7:40793190-40793212 TGCAGAAGAGGTGGAATGGAGGG + Intronic
1023678901 7:42663066-42663088 TAATGAGGAGGTGGAATTAAAGG + Intergenic
1024199707 7:47093705-47093727 TGGAGATTTGGTGAAATTAAGGG + Intergenic
1024476469 7:49817111-49817133 TGCAGAAGAGGTTAAATTTCCGG + Intronic
1026898779 7:74025999-74026021 TGCAGGGGAGGGGAAGTCAATGG - Intergenic
1027830122 7:83166460-83166482 TCCAGAGTAGCTGAAATTACAGG + Intergenic
1029269861 7:99370735-99370757 TCCAGAGGAGGTGGGATTACAGG + Intronic
1029909219 7:104126446-104126468 TGGAGAGGAAGTGAAAAGAATGG + Exonic
1030348701 7:108459543-108459565 TCAAGAGGAGCTGAAATGAAGGG + Intergenic
1031030449 7:116728560-116728582 TGAAGAGGAGATGAAACTAAGGG - Intronic
1031455455 7:121973808-121973830 TCCTGAGTAGGTGAAATTACAGG - Intronic
1031694127 7:124827907-124827929 TCCAGAGGAGCTGGAATTACAGG - Intronic
1034489312 7:151384901-151384923 TGCAAAGAAGGTGCAAATAAGGG - Intronic
1034760182 7:153665004-153665026 TCCAGAGTAGCTGAGATTAAAGG - Intergenic
1034825024 7:154254356-154254378 TGCATAGTAGGTGTAATTAGAGG + Intronic
1035560119 8:598032-598054 GGCAGAGGAGGTGATGATAAGGG + Intergenic
1039469675 8:37805476-37805498 TGCAGAGTAGCTGAGATTACAGG - Intronic
1039520748 8:38169072-38169094 TCAAGAGTAGTTGAAATTAAGGG - Intronic
1042032106 8:64487925-64487947 TGCAGAGAAGATGCAATTGAAGG - Intergenic
1043963792 8:86448579-86448601 TGAAAAGGGGATGAAATTAAGGG - Intronic
1044522146 8:93211108-93211130 TGGAAAGGAGGTTTAATTAAAGG + Intergenic
1045289944 8:100824466-100824488 TCCAGAGTAGGTGAAATGACAGG - Intergenic
1045591252 8:103600831-103600853 TGGAGAGGATGTGAAAAAAAAGG - Intronic
1046528511 8:115413541-115413563 GGCAGAGGAGGAGAAATTGAAGG - Exonic
1047031002 8:120880530-120880552 TGCACAGTAGATGAAATTCAGGG + Intergenic
1049445659 8:142630065-142630087 TGAGGTGGAGGTGATATTAATGG - Intergenic
1050047862 9:1566920-1566942 TGATGAGGATGTGAAAATAAAGG - Intergenic
1050889905 9:10811333-10811355 TGCAAAGAAGGTGACTTTAAAGG + Intergenic
1051515118 9:17922112-17922134 TGGAGATGAGGTGAAATGAATGG + Intergenic
1051781004 9:20688971-20688993 TGCAAAGGAGTTGAAACTATTGG + Intronic
1052510830 9:29417803-29417825 TGCTGAGGAGGTAAAAGTAGGGG + Intergenic
1052605521 9:30693743-30693765 TGCAGATGATGTGAAATTAAGGG + Intergenic
1052795008 9:32915505-32915527 TGGAGAGAAAGTGAAATGAAGGG + Intergenic
1052935966 9:34093439-34093461 TGGAGAGGAGCTGAAAATAGAGG + Exonic
1054458122 9:65445969-65445991 CACAGAGGACGAGAAATTAAAGG + Intergenic
1054967426 9:71045338-71045360 TACTAAGGAGGTGAAAATAAGGG - Intronic
1055017118 9:71630657-71630679 GGCAGAGGAAATGAAAGTAATGG - Intergenic
1055365042 9:75534604-75534626 TCCAGAGTAGCTGAAATTACAGG + Intergenic
1055650435 9:78401724-78401746 AGCAGAGGAGATTAAAATAAGGG - Intergenic
1056995248 9:91451119-91451141 TGGAAAGAAGGTAAAATTAAAGG - Intergenic
1057956056 9:99408879-99408901 TCCAGAGTAGCTGAAATTACAGG - Intergenic
1058539230 9:105994578-105994600 TGCAGAGTAGCTGGAATTACAGG - Intergenic
1059337464 9:113578205-113578227 TGGAGAAGGGGTGAAATTCAGGG + Intronic
1059419562 9:114182635-114182657 TGGAGAGGTGGTAAAATTTAGGG + Intronic
1059734442 9:117087356-117087378 TCCTGAGTAGCTGAAATTAAAGG + Intronic
1059763118 9:117358201-117358223 TGCAGAGGGAGAGAAAGTAAAGG + Intronic
1060641469 9:125242187-125242209 GGCAGCGGAGGGGAAAGTAAAGG - Intergenic
1202804465 9_KI270720v1_random:38275-38297 TCCAGAGGAGCTGGAATTACAGG - Intergenic
1203342930 Un_KI270442v1:10817-10839 TGCAGTGGAGTTGAAAGGAATGG + Intergenic
1203348935 Un_KI270442v1:60004-60026 TGCAGTGGAGTTGAATGTAATGG + Intergenic
1186342992 X:8662898-8662920 TCCTGAGGAGCTGAAATTACAGG - Intronic
1186601048 X:11037725-11037747 TGCTGTGGATGTGAAATGAAAGG + Intergenic
1187341307 X:18424563-18424585 TGAAGAGGTGATGAAATTGAAGG - Intergenic
1187401333 X:18963151-18963173 GGCAGAGCAGGGGAAATTATAGG - Intronic
1189201870 X:39203450-39203472 TGCAGAGGAGGTAATATGAGCGG + Intergenic
1190760816 X:53436640-53436662 TCCAGAGTAGCTGAAATTACAGG + Intergenic
1193089462 X:77478470-77478492 TGTAGAGGAGTTGAAATCAAGGG - Intergenic
1196909759 X:120473587-120473609 AGCAGAGGAAATGAACTTAAAGG + Intergenic
1197249983 X:124205458-124205480 TCCAGAGGAGGTGTCATTTATGG - Intronic
1197561719 X:128032207-128032229 TGCATAGGTGGTGAAATTTGGGG - Intergenic
1199557592 X:149125828-149125850 TCCAGAGGAGGTGAAACTTCTGG + Intergenic
1201121296 Y:10875550-10875572 TGGAGAGGAGTGGAATTTAATGG - Intergenic
1201122894 Y:10886755-10886777 TGCAGAGGAGTGGAAAGGAATGG - Intergenic
1201129662 Y:10943011-10943033 TGCAGTGGAGTTGAAAGGAATGG - Intergenic
1201130363 Y:10947541-10947563 TGGAGTGGAGTTGAAAATAATGG - Intergenic
1201131618 Y:10956049-10956071 TGGAGTGGAGTTGAATTTAATGG - Intergenic
1201137498 Y:11000972-11000994 TGCAGAGGAGGTGAGAGGAGTGG - Intergenic