ID: 1134238469

View in Genome Browser
Species Human (GRCh38)
Location 16:12486321-12486343
Sequence CTGTACAGGGGCCACTGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134238469_1134238473 -8 Left 1134238469 16:12486321-12486343 CCTCTGCAGTGGCCCCTGTACAG No data
Right 1134238473 16:12486336-12486358 CTGTACAGTAGCATATTCACAGG No data
1134238469_1134238475 -1 Left 1134238469 16:12486321-12486343 CCTCTGCAGTGGCCCCTGTACAG No data
Right 1134238475 16:12486343-12486365 GTAGCATATTCACAGGTTCTGGG No data
1134238469_1134238479 22 Left 1134238469 16:12486321-12486343 CCTCTGCAGTGGCCCCTGTACAG No data
Right 1134238479 16:12486366-12486388 GATTGAGGCATAGACACTTTGGG No data
1134238469_1134238474 -2 Left 1134238469 16:12486321-12486343 CCTCTGCAGTGGCCCCTGTACAG No data
Right 1134238474 16:12486342-12486364 AGTAGCATATTCACAGGTTCTGG 0: 4
1: 31
2: 112
3: 358
4: 728
1134238469_1134238476 0 Left 1134238469 16:12486321-12486343 CCTCTGCAGTGGCCCCTGTACAG No data
Right 1134238476 16:12486344-12486366 TAGCATATTCACAGGTTCTGGGG 0: 8
1: 97
2: 290
3: 604
4: 1209
1134238469_1134238480 27 Left 1134238469 16:12486321-12486343 CCTCTGCAGTGGCCCCTGTACAG No data
Right 1134238480 16:12486371-12486393 AGGCATAGACACTTTGGGAGAGG No data
1134238469_1134238478 21 Left 1134238469 16:12486321-12486343 CCTCTGCAGTGGCCCCTGTACAG No data
Right 1134238478 16:12486365-12486387 GGATTGAGGCATAGACACTTTGG No data
1134238469_1134238477 7 Left 1134238469 16:12486321-12486343 CCTCTGCAGTGGCCCCTGTACAG No data
Right 1134238477 16:12486351-12486373 TTCACAGGTTCTGGGGATTGAGG No data
1134238469_1134238481 28 Left 1134238469 16:12486321-12486343 CCTCTGCAGTGGCCCCTGTACAG No data
Right 1134238481 16:12486372-12486394 GGCATAGACACTTTGGGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134238469 Original CRISPR CTGTACAGGGGCCACTGCAG AGG (reversed) Intronic
No off target data available for this crispr