ID: 1134238470

View in Genome Browser
Species Human (GRCh38)
Location 16:12486333-12486355
Sequence GTGAATATGCTACTGTACAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134238470_1134238482 19 Left 1134238470 16:12486333-12486355 CCCCTGTACAGTAGCATATTCAC No data
Right 1134238482 16:12486375-12486397 ATAGACACTTTGGGAGAGGGTGG No data
1134238470_1134238477 -5 Left 1134238470 16:12486333-12486355 CCCCTGTACAGTAGCATATTCAC No data
Right 1134238477 16:12486351-12486373 TTCACAGGTTCTGGGGATTGAGG No data
1134238470_1134238480 15 Left 1134238470 16:12486333-12486355 CCCCTGTACAGTAGCATATTCAC No data
Right 1134238480 16:12486371-12486393 AGGCATAGACACTTTGGGAGAGG No data
1134238470_1134238483 20 Left 1134238470 16:12486333-12486355 CCCCTGTACAGTAGCATATTCAC No data
Right 1134238483 16:12486376-12486398 TAGACACTTTGGGAGAGGGTGGG No data
1134238470_1134238478 9 Left 1134238470 16:12486333-12486355 CCCCTGTACAGTAGCATATTCAC No data
Right 1134238478 16:12486365-12486387 GGATTGAGGCATAGACACTTTGG No data
1134238470_1134238479 10 Left 1134238470 16:12486333-12486355 CCCCTGTACAGTAGCATATTCAC No data
Right 1134238479 16:12486366-12486388 GATTGAGGCATAGACACTTTGGG No data
1134238470_1134238481 16 Left 1134238470 16:12486333-12486355 CCCCTGTACAGTAGCATATTCAC No data
Right 1134238481 16:12486372-12486394 GGCATAGACACTTTGGGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134238470 Original CRISPR GTGAATATGCTACTGTACAG GGG (reversed) Intronic
No off target data available for this crispr