ID: 1134238474

View in Genome Browser
Species Human (GRCh38)
Location 16:12486342-12486364
Sequence AGTAGCATATTCACAGGTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1233
Summary {0: 4, 1: 31, 2: 112, 3: 358, 4: 728}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134238469_1134238474 -2 Left 1134238469 16:12486321-12486343 CCTCTGCAGTGGCCCCTGTACAG No data
Right 1134238474 16:12486342-12486364 AGTAGCATATTCACAGGTTCTGG 0: 4
1: 31
2: 112
3: 358
4: 728
1134238465_1134238474 13 Left 1134238465 16:12486306-12486328 CCCTTAATTTCACCTCCTCTGCA 0: 1
1: 0
2: 2
3: 32
4: 401
Right 1134238474 16:12486342-12486364 AGTAGCATATTCACAGGTTCTGG 0: 4
1: 31
2: 112
3: 358
4: 728
1134238468_1134238474 1 Left 1134238468 16:12486318-12486340 CCTCCTCTGCAGTGGCCCCTGTA No data
Right 1134238474 16:12486342-12486364 AGTAGCATATTCACAGGTTCTGG 0: 4
1: 31
2: 112
3: 358
4: 728
1134238466_1134238474 12 Left 1134238466 16:12486307-12486329 CCTTAATTTCACCTCCTCTGCAG No data
Right 1134238474 16:12486342-12486364 AGTAGCATATTCACAGGTTCTGG 0: 4
1: 31
2: 112
3: 358
4: 728
1134238463_1134238474 26 Left 1134238463 16:12486293-12486315 CCCTGTGTCAGGGCCCTTAATTT No data
Right 1134238474 16:12486342-12486364 AGTAGCATATTCACAGGTTCTGG 0: 4
1: 31
2: 112
3: 358
4: 728
1134238464_1134238474 25 Left 1134238464 16:12486294-12486316 CCTGTGTCAGGGCCCTTAATTTC No data
Right 1134238474 16:12486342-12486364 AGTAGCATATTCACAGGTTCTGG 0: 4
1: 31
2: 112
3: 358
4: 728

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134238474 Original CRISPR AGTAGCATATTCACAGGTTC TGG Intronic
900865992 1:5269046-5269068 AGTTGCATATTCACAGGTTCTGG - Intergenic
901758384 1:11455218-11455240 GGCGCCATATTCACAGGTTCTGG + Intergenic
901826001 1:11861722-11861744 AGTAGTATATTCGCAGATTCTGG - Intergenic
902087944 1:13877544-13877566 GGTAACATATTCCCAGGGTCTGG + Intergenic
902108268 1:14056200-14056222 AGTAGCATATTCACAGTTTCTGG - Intergenic
902113689 1:14103817-14103839 GGTATCATATGCACAGGTTCCGG + Intergenic
902293572 1:15450920-15450942 GGTAACATGTTCACAGGTTCTGG - Intergenic
902567354 1:17321007-17321029 GGTAACATCTTCACAGGTTTGGG + Intronic
903376922 1:22872446-22872468 GGTAACATATTCACAGATCCCGG + Intronic
903456840 1:23493396-23493418 TATCACATATTCACAGGTTCGGG + Intergenic
903565554 1:24262727-24262749 GGTAACATATTCACAAGCTCTGG + Intergenic
903678509 1:25081890-25081912 AGTAATGTATTCACAGGTTTCGG - Intergenic
904916217 1:33972409-33972431 AGCAGCATATTTCCATGTTCTGG - Intronic
905392023 1:37642339-37642361 GGTAACATATTCACAGGTTTGGG + Intergenic
905737659 1:40341027-40341049 TGTAACAGATTCACAGGTTCTGG + Intergenic
905993681 1:42362510-42362532 GGTAACATAGTCACAGGTCCTGG - Intergenic
906958434 1:50397369-50397391 AACAACATATTCACAGGTTCTGG + Intergenic
907580558 1:55568510-55568532 GGTCACATATTCACAGGTTTTGG - Intergenic
907785889 1:57612320-57612342 GGTAACATAATCACAGGTTTTGG - Intronic
908067318 1:60421019-60421041 AGTATCAAATTCAAAGGTTCTGG - Intergenic
908087626 1:60653255-60653277 AGGTACATATCCACAGGTTCTGG + Intergenic
908475501 1:64483921-64483943 AGCAGCAAGTTCAAAGGTTCTGG - Intronic
908811850 1:67989547-67989569 GGTAACATAGTCACAGGTTCTGG - Intergenic
908888130 1:68813506-68813528 GGTAACATATTCATACGTTCTGG - Intergenic
908897976 1:68922802-68922824 GGTAACATATTCACAGGTTCTGG - Intergenic
909480055 1:76121175-76121197 AGTAACATATTCACAGGTTTTGG + Intronic
909600753 1:77458807-77458829 AGTAACATATTCACAGCTTCTGG + Intronic
910418944 1:87034826-87034848 AGTGACATAATCACAGGTTCTGG - Intronic
910492512 1:87788055-87788077 ATTAGCATATTCATAGGAGCAGG + Intergenic
910593353 1:88951821-88951843 GGTAACATATTTACAAGTTCTGG - Intronic
911220453 1:95240166-95240188 GGGAGCGTATTCACAGCTTCTGG + Intronic
911345594 1:96693021-96693043 GGTAACATATTCACAATTTCTGG - Intergenic
911740551 1:101382482-101382504 GGTAACCCATTCACAGGTTCTGG + Intergenic
911783796 1:101918690-101918712 AATAACATATTCACGGGTTCTGG + Intronic
912024420 1:105149224-105149246 CATAGCATATTCATAGGCTCTGG + Intergenic
912135043 1:106650631-106650653 GTTATCATATTCACAGTTTCTGG + Intergenic
912356490 1:109058280-109058302 AGTAACATATTCTCAGGTCCTGG - Intergenic
912816951 1:112837033-112837055 AGTAGCACAATCACTGGATCAGG - Intergenic
913390642 1:118307741-118307763 TATAACATATTCACAGGTCCTGG - Intergenic
913478315 1:119260365-119260387 GGTAACATGTTTACAGGTTCTGG + Intergenic
913582373 1:120238893-120238915 AGTGGCATATACACAGGATCTGG + Intergenic
913625800 1:120659490-120659512 AGTGGCATATACACAGGATCTGG - Intergenic
914564308 1:148850368-148850390 AGTGGCATATACACAGGATCTGG + Intronic
914608518 1:149279871-149279893 AGTGGCATATACACAGGATCTGG - Intergenic
914991991 1:152506835-152506857 GGTGATATATTCACAGGTTCTGG + Intergenic
915144796 1:153790143-153790165 CTTAGCACATTCATAGGTTCCGG + Intergenic
915153661 1:153856263-153856285 CGGAACATATTCACAGGTTATGG + Intronic
915278431 1:154805840-154805862 TATAACATAGTCACAGGTTCTGG - Intronic
915743332 1:158136945-158136967 GGTAACTTATTCACAGATTCTGG - Intergenic
915775400 1:158479574-158479596 TCTAACATATTCTCAGGTTCTGG - Intergenic
916093743 1:161330041-161330063 GATAATATATTCACAGGTTCTGG + Intronic
916238587 1:162615358-162615380 GGTAACATATTCTCAGGTTCTGG + Intergenic
916408096 1:164517645-164517667 AGTAACATATTCACAGGTCCTGG + Intergenic
916949272 1:169762442-169762464 TGTAACATATTCACAAGTTCTGG - Intronic
917129836 1:171729835-171729857 GGTAACACATTCACAGGTTTTGG - Intronic
917233258 1:172861345-172861367 GGAAACATATTCACAGGTTTGGG - Intergenic
917286463 1:173426463-173426485 AGCAGCACATTTACAGGTTCTGG - Intergenic
917584258 1:176409902-176409924 TGTAACATATTCACAGGCTGTGG - Intergenic
917794639 1:178524085-178524107 CATAACATATTCACAGGCTCAGG + Intronic
918057281 1:181032966-181032988 GGTAATATATCCACAGGTTCTGG + Intergenic
918134964 1:181663651-181663673 AGGAGCATAATCACTGGTACTGG + Intronic
919013854 1:192002479-192002501 GGCAACATATTCACAAGTTCTGG + Intergenic
919107508 1:193171753-193171775 GTTAAAATATTCACAGGTTCTGG + Intronic
919232961 1:194799549-194799571 AGTAACATATTCTCTGGTTTTGG - Intergenic
919294716 1:195681548-195681570 TGTAACAGATTCACAGGTTCTGG + Intergenic
919327796 1:196131280-196131302 GGTAACATAATCACTGGTTCTGG - Intergenic
919591352 1:199507492-199507514 AGTAGCATATGCTCAGGTACGGG + Intergenic
919830411 1:201536902-201536924 AATAGCATATGGACAGGTTGAGG - Intergenic
919950253 1:202356478-202356500 GGTAACATATTTACATGTTCTGG - Intronic
921237084 1:213144130-213144152 AATAACATAGACACAGGTTCTGG + Intronic
921254020 1:213323280-213323302 GGTAACATATTCACAAGTTTTGG + Intergenic
921357394 1:214298663-214298685 ATTAACTTCTTCACAGGTTCTGG - Intronic
922390035 1:225131634-225131656 GGTGACATATTCACAGGTTCTGG + Intronic
922564921 1:226595559-226595581 AGTAGCATATTCACAGGTTTGGG - Intronic
923181247 1:231521938-231521960 GATAACACATTCACAGGTTCTGG + Intergenic
923625874 1:235613365-235613387 ATTATCATGTTCACAGGTTCTGG - Intronic
923788390 1:237090279-237090301 AGTAACATATTTACAGGTTCTGG - Intronic
924143638 1:241051265-241051287 ACTGGCATATTCACAGGTTCTGG + Intronic
924322015 1:242859985-242860007 GGGGACATATTCACAGGTTCCGG - Intergenic
924503607 1:244659756-244659778 TGTAACATGTTCACAGGTTCTGG + Intronic
924718340 1:246599680-246599702 AGCAGCATATTTATAAGTTCTGG + Intronic
924738557 1:246780886-246780908 AGTAATATATTCACAGGTTCTGG - Intergenic
1062767585 10:77202-77224 AGTGGCATAATCACAGTTCCTGG + Intergenic
1063131414 10:3180784-3180806 CATAGCATATTCACAAATTCTGG + Intergenic
1063163531 10:3438753-3438775 TGTCACATATTCACAGGCTCTGG + Intergenic
1063758834 10:9048119-9048141 TGTAACATATTTACAGGGTCTGG + Intergenic
1063774487 10:9245798-9245820 AGTAACATATTCACAATTTCTGG - Intergenic
1064317320 10:14270364-14270386 GGTAACATCTTCACAGGTTCTGG + Intronic
1064532150 10:16321600-16321622 CGTAGCGTATTTATAGGTTCTGG - Intergenic
1064540204 10:16397446-16397468 AGTCACATATTCCCAGGCTCTGG + Intergenic
1064857835 10:19791515-19791537 AGTAAGATATTCATAGGTTCTGG - Intergenic
1064871858 10:19946444-19946466 AGTAACAGAGTCACAGGTTCTGG - Intronic
1065434223 10:25690663-25690685 AATAACATATGCACAGGTTCTGG + Intergenic
1065620512 10:27576326-27576348 GATAATATATTCACAGGTTCTGG + Intergenic
1065675046 10:28165173-28165195 GGTAACATAGTCACAGGCTCGGG - Intronic
1066061486 10:31727464-31727486 GGTAACATATTCACAGATTCTGG - Intergenic
1066191562 10:33060844-33060866 GGTAACATATTCACAGGTTCCGG - Intergenic
1066433553 10:35375522-35375544 GGTAATATATTCACAGGTTATGG + Intronic
1066589131 10:36973910-36973932 AGTAACACATTCACAGGTTCTGG - Intergenic
1068043431 10:51856254-51856276 GGTAACATATTTACAGGTTCCGG + Intronic
1068391401 10:56401912-56401934 GGAAACATATTCACAGGCTCTGG - Intergenic
1068516158 10:58027929-58027951 AGTAACATATTCATAGGATTAGG + Intergenic
1068599993 10:58946710-58946732 GATAACATATTCACAGGTTCTGG + Intergenic
1068686406 10:59874572-59874594 AGTAACATTTTCATAGGTTCTGG - Intronic
1069202873 10:65645037-65645059 GGTTGCATATTCACAGGTTCTGG - Intergenic
1069321439 10:67176603-67176625 GGTAACATATTCATAGGTTCTGG - Intronic
1070921442 10:80189042-80189064 AGTAACGCATTCACAGGTACCGG - Intronic
1071090180 10:81909334-81909356 AAGATCACATTCACAGGTTCTGG + Intronic
1071114022 10:82195635-82195657 AATAACATATTCACATGTTCTGG - Intronic
1071320732 10:84454373-84454395 AATGTCATATTCACAGGTTCTGG + Intronic
1071713065 10:88068582-88068604 GGTAACATATTCACAGGTTCTGG + Intergenic
1071727026 10:88209233-88209255 AAGATCACATTCACAGGTTCTGG - Intergenic
1071791234 10:88956551-88956573 GGTAACATATCCACAGGTTTAGG + Intronic
1071806127 10:89123096-89123118 GGTAACCTATTCATAGGTTCTGG + Intergenic
1071834425 10:89405848-89405870 AGTAGCATGTTCACAGGTTCTGG + Intronic
1071935833 10:90529134-90529156 GGTAACATATTCACAGGTTCTGG + Intergenic
1072347205 10:94519924-94519946 AGCAACATATTCATAGCTTCTGG + Intronic
1073055275 10:100696136-100696158 AGGTAAATATTCACAGGTTCTGG - Intergenic
1073058463 10:100717531-100717553 GATAGCATATTCATAGGTTTTGG - Intergenic
1073395499 10:103213928-103213950 TGTAACATAATCACAGGTCCTGG - Intergenic
1073698641 10:105899223-105899245 AGTAACCCATTGACAGGTTCTGG - Intergenic
1073742705 10:106426849-106426871 GGCAACATATTCACAAGTTCAGG + Intergenic
1074027062 10:109647337-109647359 GGTACCGTATTCACAGGTTCTGG + Intergenic
1074220828 10:111436225-111436247 AGGAGCATATTCACAGGTTCTGG + Intergenic
1074425083 10:113343549-113343571 GGTAACATATTCACAGGTTCTGG - Intergenic
1074494069 10:113963654-113963676 GGTAACATATTCACAGGTTCCGG + Intergenic
1074851838 10:117445322-117445344 GGTAATATATTCACAGGTTCCGG + Intergenic
1075024610 10:118975405-118975427 GGTAACATATTCACAGGTCTTGG + Intergenic
1075283130 10:121158422-121158444 ACTAACATATTCACAGGTTGTGG + Intergenic
1075682960 10:124345504-124345526 GGTAAGGTATTCACAGGTTCCGG + Intergenic
1075978479 10:126717473-126717495 CATAGGATATCCACAGGTTCTGG - Intergenic
1076152476 10:128173739-128173761 GGTAGCATATTCATAGTTTGGGG - Intergenic
1078715948 11:13839128-13839150 GGTAGCATATTCACAGATTTGGG + Intergenic
1079022129 11:16917720-16917742 GGTAACATATTCACAGGTTCTGG + Intronic
1079370951 11:19851773-19851795 GATAACATATTCACAGGTTCTGG - Intronic
1079386974 11:19989139-19989161 CTTAACATATCCACAGGTTCTGG - Intronic
1079469924 11:20768524-20768546 AGTAATATAGTCACAGGTTATGG - Intronic
1080050089 11:27850877-27850899 AGTCATATATTCACAAGTTCTGG + Intergenic
1080357822 11:31472185-31472207 GGCAACATATTCAAAGGTTCTGG + Intronic
1080420573 11:32106499-32106521 AAGATCACATTCACAGGTTCTGG + Intergenic
1080615133 11:33939161-33939183 CATAACATATCCACAGGTTCTGG - Intergenic
1080708800 11:34725580-34725602 GGTAACATAGTCACAGGTTCTGG - Intergenic
1080728331 11:34919051-34919073 AACAGCATATTCATAGGTTCTGG + Intronic
1080999133 11:37645741-37645763 AGTAACGTATTCACAGGTTCTGG + Intergenic
1081101584 11:39008434-39008456 AGTAAAATATCCATAGGTTCTGG - Intergenic
1081188284 11:40072184-40072206 CCTAACATATTCACACGTTCTGG - Intergenic
1081244146 11:40743575-40743597 ACTAACATATTCACAGGTTCTGG + Intronic
1081375359 11:42351957-42351979 GGTCACATATTAACAGGTTCTGG - Intergenic
1081677944 11:44981859-44981881 GGTAACATATTCACAGGTTCTGG + Intergenic
1081679631 11:44992571-44992593 AGAAGCATGTTCACAGGTAGGGG + Intergenic
1081725994 11:45329632-45329654 ATGATCATATTCACAGGTTCTGG - Intergenic
1081844820 11:46232760-46232782 CATAGCATATTCACAGGTTCTGG - Intergenic
1081884134 11:46480235-46480257 AGTAACATATTCACAGGTTCTGG + Intronic
1082274082 11:50202567-50202589 GATAACATATTCACACGTTCTGG - Intergenic
1082274131 11:50203064-50203086 GATAACATATTCACATGTTCTGG + Intergenic
1083983210 11:66191384-66191406 GGTACCATATTCACAGGTTTTGG + Intronic
1084643526 11:70440479-70440501 GGTAACATCATCACAGGTTCTGG - Intergenic
1084659230 11:70537301-70537323 AAAGTCATATTCACAGGTTCCGG - Intronic
1084724186 11:70929761-70929783 AGTAACATGTGCACAGGTTTGGG + Intronic
1085039660 11:73319484-73319506 GGTGACATATTCACAGGTTCTGG + Intronic
1085821422 11:79797713-79797735 GGTAACACATTCACAGGTTCTGG - Intergenic
1086534997 11:87833860-87833882 TGTGACATATTCACAGGTTTTGG - Intergenic
1086585910 11:88450728-88450750 GGGAACATATTCACAGGTTTTGG - Intergenic
1086726293 11:90188927-90188949 CCTAACATATTCAAAGGTTCTGG - Intronic
1087320291 11:96650164-96650186 AGTAACATATTCATAAGTTCTGG + Intergenic
1087586502 11:100128438-100128460 AGTGACATACTTACAGGTTCTGG - Intronic
1087958349 11:104317740-104317762 AGCAACATAATCACAGGTTTTGG + Intergenic
1087974928 11:104532925-104532947 TGTAACATATTCATAGGTTCTGG + Intergenic
1088247829 11:107836436-107836458 GGTAACCTATTCACAGGTTCAGG - Intronic
1088536156 11:110863907-110863929 AATATCACATTCAAAGGTTCTGG + Intergenic
1088799440 11:113291892-113291914 AGTACAATATTCACAGGTGCTGG - Intergenic
1088963487 11:114694271-114694293 CTTAACATATTCACAGGTTTTGG + Intronic
1088998651 11:115029163-115029185 GGTTGCATATTCACAAGCTCTGG - Intergenic
1089162722 11:116451957-116451979 AGTAACATAGTCACAGGTTCTGG + Intergenic
1089635614 11:119809762-119809784 AGTCACATATTCCCAGGCTCTGG + Intergenic
1091049577 11:132355297-132355319 GGTAACATATTCACAATTTCTGG + Intergenic
1091160538 11:133415631-133415653 GGTACCACATGCACAGGTTCCGG - Intronic
1091713259 12:2757626-2757648 AGTAACACATTTATAGGTTCAGG - Intergenic
1091946917 12:4554416-4554438 GGTAACATATTCACATGTTCTGG + Intronic
1092142657 12:6194587-6194609 AGTAACACATTCACAGTTTTGGG + Intergenic
1093027182 12:14255492-14255514 AATAGAATCTTCACAGCTTCTGG - Intergenic
1093175130 12:15904964-15904986 GATGACATATTCACAGGTTCTGG + Intergenic
1093323238 12:17740130-17740152 CATAACATATTCACAAGTTCTGG + Intergenic
1093390405 12:18612180-18612202 AGTAGCAGATACAAAGGTCCTGG - Intronic
1093669556 12:21857517-21857539 GGTAACACAGTCACAGGTTCTGG - Intronic
1093786600 12:23199010-23199032 GGTTACATATTCAAAGGTTCTGG - Intergenic
1093908591 12:24720589-24720611 AGTAAGATTTTCACAGGTTCTGG - Intergenic
1094081818 12:26545196-26545218 GGTAACATGTTTACAGGTTCTGG - Intronic
1094249425 12:28341950-28341972 TGCAACATATTCACAGATTCTGG - Intronic
1094394660 12:29992669-29992691 AACAACATATTCACAGGTTGGGG + Intergenic
1095242294 12:39875488-39875510 TGCAACATATTCACAGGCTCTGG + Intronic
1095282084 12:40364391-40364413 ATTAGACTATTCACTGGTTCTGG + Intronic
1095393927 12:41741620-41741642 GGTAACATATTCGCAGATTCTGG + Intergenic
1095685171 12:45025074-45025096 CATAACATATTCACAGGTTCTGG - Intronic
1095735139 12:45548044-45548066 GTAAACATATTCACAGGTTCTGG - Intergenic
1095865667 12:46969299-46969321 GGTAACATATTCACAGGTTCTGG + Intergenic
1095870312 12:47019487-47019509 AGTAGCATAGACACAGGCTTTGG - Intergenic
1095948988 12:47771462-47771484 GGTGACATATTCATAGGTTCTGG - Intronic
1096356735 12:50947642-50947664 TGTAACACATTCCCAGGTTCTGG + Intergenic
1097520052 12:60656099-60656121 TATAACGTATTCACAGGTTCTGG + Intergenic
1097647497 12:62253795-62253817 AGTAATATATTCACAAGTTCTGG + Intronic
1098084730 12:66830229-66830251 GGTAACATATTCACAGGTTCTGG - Intergenic
1098429119 12:70400518-70400540 TGTAGTATATTCACAGGGTAAGG - Intronic
1098445955 12:70565778-70565800 GGTAACATATTCACAGGTTCTGG - Intronic
1098526418 12:71492077-71492099 AGTTGGATATTTATAGGTTCAGG + Intronic
1098571903 12:71997353-71997375 GGTAACATATTCACAGGTTCTGG + Intronic
1098602448 12:72347876-72347898 AGAAGCATATTACCAGGCTCAGG + Intronic
1098656853 12:73042080-73042102 AGTAGTATATTTACTGCTTCTGG - Intergenic
1099015191 12:77336139-77336161 AGTGACATATTCACAGGTTCTGG - Intergenic
1099593110 12:84621462-84621484 AGTAGCATGACCACAGGTGCAGG + Intergenic
1099595139 12:84653049-84653071 AGTAACATATTCACAGGTTCTGG + Intergenic
1099714621 12:86275492-86275514 GGTAACATATTCCCAGGTTCCGG - Intronic
1099731894 12:86515063-86515085 TGAAGCATATTCACGAGTTCTGG + Intronic
1099751196 12:86774671-86774693 AGAATCATATTAACAGGTTAAGG - Intronic
1099923025 12:88982719-88982741 GGTAACACATTCACAGGTTCTGG + Intergenic
1099927479 12:89035284-89035306 GATAGCATATTCACAACTTCTGG - Intergenic
1100432467 12:94542895-94542917 AGTATCATATTCCCAAGTACTGG - Intergenic
1100660090 12:96687280-96687302 GGTCACATATTCATAGGTTCTGG + Intronic
1100667770 12:96772944-96772966 TCTAACATATTCACAGATTCTGG + Intronic
1100700110 12:97138328-97138350 CGTAAAATATGCACAGGTTCTGG + Intergenic
1100707819 12:97220634-97220656 AAAATCACATTCACAGGTTCTGG + Intergenic
1100720985 12:97357951-97357973 ACTAGCTTCTTCTCAGGTTCTGG - Intergenic
1100939657 12:99712325-99712347 GGTAAAATATTCACAGGTTCTGG - Intronic
1101062187 12:100983853-100983875 CATAACATATTCACAGGTTCTGG + Intronic
1101229434 12:102724891-102724913 GGTGACATATTCACAGGTTCTGG - Intergenic
1101572988 12:105972175-105972197 TGTAACATAGTCCCAGGTTCTGG - Intergenic
1101740846 12:107498808-107498830 CATAGCATATTCAAAGGTTCTGG + Intronic
1101817236 12:108154564-108154586 GGTCACATATTCACAGGTTATGG + Intronic
1102413805 12:112743182-112743204 GGTAACATAGTCACAGGTTCTGG + Intronic
1102447842 12:113017240-113017262 GGTAACATATTCACAGGTTCTGG + Intergenic
1102525264 12:113508071-113508093 AGTTACATATTCACAGGTTCTGG - Intergenic
1102813209 12:115841828-115841850 CCCAGCATATTTACAGGTTCTGG - Intergenic
1102924382 12:116815714-116815736 GGTACCAAATTCATAGGTTCTGG + Intronic
1103157852 12:118702186-118702208 AATTACATATTCACGGGTTCTGG - Intergenic
1103905137 12:124323496-124323518 AGTATCATATACACAGGGTGAGG - Intergenic
1103963716 12:124624978-124625000 GGTAACATGTTCTCAGGTTCTGG - Intergenic
1103974695 12:124694882-124694904 AAGATCACATTCACAGGTTCAGG - Intergenic
1103996455 12:124833536-124833558 GGTCACATATTCACAGGTCCTGG + Intronic
1104060539 12:125264346-125264368 AGTAACATATTCACAGGTTCTGG + Intronic
1104063508 12:125287342-125287364 GGTAACATCTTCACAGGTTCTGG + Intronic
1104074755 12:125379173-125379195 CATAACATATTCACAGGTTCTGG - Intronic
1104074898 12:125380405-125380427 AAGTTCATATTCACAGGTTCTGG + Intronic
1104091755 12:125523546-125523568 AGTAACATATTCACAGGTTCTGG + Intronic
1104166868 12:126240100-126240122 CCTAACATACTCACAGGTTCTGG + Intergenic
1104170336 12:126274473-126274495 GGGAGCATATTCACAGGTTCTGG + Intergenic
1104177326 12:126345620-126345642 GATAACATATTCAAAGGTTCTGG + Intergenic
1104222300 12:126796726-126796748 GGTAACATATTCATAGATTCTGG + Intergenic
1104228511 12:126860614-126860636 TGTAACACATTCACAAGTTCTGG - Intergenic
1104369964 12:128215798-128215820 GGTCACATAATCACAGGTTCCGG - Intergenic
1104372279 12:128234602-128234624 GGTGACATATTCACAGGTTCTGG + Intergenic
1104547312 12:129723935-129723957 AGTGACATAGTCACCGGTTCTGG - Intronic
1104690631 12:130823379-130823401 GGTGACATATTCACAGGCTCTGG - Intronic
1106122193 13:26869769-26869791 ACTAACATACTCACAGGTTCTGG + Intergenic
1106139852 13:27003070-27003092 GGTGACATATTCACAGGTTCCGG - Intergenic
1106197681 13:27508345-27508367 AATAGCCAACTCACAGGTTCTGG + Intergenic
1106764514 13:32900457-32900479 CCTAACATATTCACAGGTTCTGG + Intergenic
1107161055 13:37228442-37228464 GGTAGAATAGTCACAGATTCTGG + Intergenic
1107177947 13:37421900-37421922 TGTAGTATATTCACAGGTGCTGG + Intergenic
1107237594 13:38191484-38191506 GGTAACGTGTTCACAGGTTCTGG + Intergenic
1107323649 13:39216226-39216248 CATAACATATTCACAGGTTCTGG + Intergenic
1107378381 13:39829393-39829415 AATAATGTATTCACAGGTTCTGG + Intergenic
1107988173 13:45793799-45793821 AAGATCACATTCACAGGTTCTGG - Intronic
1108033047 13:46256914-46256936 TATAACATATTCACATGTTCTGG - Intronic
1108182337 13:47853537-47853559 AGTGGCATATTCACAGCTTCTGG - Intergenic
1108465926 13:50715341-50715363 TGTAAGCTATTCACAGGTTCTGG + Intronic
1108557370 13:51607808-51607830 TGTAACATAATCACAGGATCTGG - Intronic
1108697370 13:52914232-52914254 GGTAATATATTCACAGATTCAGG - Intergenic
1108917150 13:55629121-55629143 AGTAACATATTCACACGTTTGGG - Intergenic
1109281974 13:60367233-60367255 GGTTGCATATTCACAGTTTCTGG + Intergenic
1109495977 13:63172267-63172289 GGTTACATATTCACAGGTTCTGG + Intergenic
1109605757 13:64693007-64693029 AGTAAAATATTCACAGGTATTGG - Intergenic
1109799833 13:67362381-67362403 GGTATCATATTAACAGGTCCTGG + Intergenic
1109823485 13:67687746-67687768 TGTAACATATTCACAGGTTTAGG + Intergenic
1110120054 13:71868614-71868636 AGTAGCAGGTTCACAGGGTTGGG + Intergenic
1110817408 13:79877153-79877175 AGTAACATTTTTACAAGTTCAGG + Intergenic
1110827582 13:79990599-79990621 TGTAACATATTCACAGGTTCTGG - Intergenic
1111042250 13:82764251-82764273 AATAGCACACTCAAAGGTTCAGG - Intergenic
1111587683 13:90303885-90303907 GGTAACATATTCTCAGGTTTGGG - Intergenic
1111729564 13:92056420-92056442 GGTAACATACTCACAGGTTTTGG + Intronic
1111818395 13:93183617-93183639 GGTAACATATTCAAAGGTTCTGG + Intergenic
1112460507 13:99599932-99599954 AGTAACATAGTCACAGGTGCCGG + Intergenic
1112715644 13:102181813-102181835 GGTAATGTATTCACAGGTTCTGG + Intronic
1113753985 13:112796304-112796326 AGTGTCATAGTCAGAGGTTCTGG - Intronic
1114371106 14:22089483-22089505 AGCAGCATATTCATAGACTCTGG - Intergenic
1115034600 14:28841788-28841810 ATTAACATTTTCACAGGTTCTGG + Intergenic
1115579549 14:34744591-34744613 AGTAACATATTCACAGTTCCAGG - Intergenic
1115593274 14:34884867-34884889 GATAACATATTCACAGGTTATGG - Intergenic
1115836681 14:37413615-37413637 CCTAACATATTCACAGGTTCTGG + Intronic
1116001878 14:39252190-39252212 AGTAACATATTCTCAGGGTCTGG - Intronic
1116091530 14:40313227-40313249 ACTAGCAGATTCACAGTGTCTGG - Intergenic
1116655899 14:47653596-47653618 TCTAACATATTCACAGTTTCCGG - Intronic
1116712546 14:48386649-48386671 GGTAACATATTGACAGGTTTGGG + Intergenic
1116963825 14:50993981-50994003 AATAACATATTCACAGGTTCTGG - Intronic
1117105857 14:52396144-52396166 GGTGGCATATTCACAGGTTGTGG - Intergenic
1117319683 14:54609062-54609084 CATAACATTTTCACAGGTTCTGG - Intronic
1117433930 14:55698483-55698505 CATAACACATTCACAGGTTCTGG + Intronic
1117467674 14:56009642-56009664 GTTAACATATTCACAGGTTCTGG + Intergenic
1117528576 14:56636836-56636858 GGTAACATATTCACAGGTTGTGG - Intronic
1117790864 14:59340511-59340533 AGTAGCATTGTCACAGAATCAGG + Intronic
1117794618 14:59379569-59379591 GGTAATATATTCACAGGTTCTGG - Intergenic
1118009256 14:61592602-61592624 GGTAACATATTCACAGGTTTTGG + Intronic
1118069345 14:62228751-62228773 AGTAATATATTAACAGGTTCTGG + Intergenic
1118377902 14:65192745-65192767 GGTAACACATTCACAGGTTCTGG - Intergenic
1119045276 14:71313508-71313530 GGTAACATATTCACAGGTTTTGG + Intergenic
1119141880 14:72274550-72274572 GGTAACATATGCACAGGTTCTGG - Intronic
1119165284 14:72487410-72487432 CATAACCTATTCACAGGTTCTGG - Intronic
1119571606 14:75679101-75679123 GATAACATATTCACAGATTCTGG - Intronic
1119625565 14:76171663-76171685 AGTGGCGTAATCACATGTTCAGG - Intronic
1119679297 14:76579964-76579986 CATAACATATTCCCAGGTTCAGG + Intergenic
1120185984 14:81394480-81394502 AGTAACATATTCACAGGTTCTGG - Intronic
1120558682 14:85962435-85962457 GGTAGCATATTGACAGATTCTGG - Intergenic
1120737203 14:88066312-88066334 AGTAACATATTCAGAGGTTCTGG + Intergenic
1121077566 14:91082056-91082078 AGTAACATATTCACAGGCTCTGG + Intronic
1121288958 14:92758957-92758979 GGTAATATATTCACAGATTCTGG - Intergenic
1121454699 14:94030685-94030707 GGTAACATAGTCACAGGTTGTGG - Intronic
1121717655 14:96087790-96087812 AGAAGCACTTTCACAGCTTCAGG - Exonic
1121794848 14:96726286-96726308 GGTAACGTATTCACAGATTCTGG - Intergenic
1121856614 14:97276212-97276234 GGTCACATATTCACAGGTTTGGG - Intergenic
1122014554 14:98783403-98783425 CCTAGCACATGCACAGGTTCTGG - Intergenic
1122034301 14:98936282-98936304 AGTGACATATTCACAGGTCCCGG - Intergenic
1123453008 15:20385154-20385176 ACTAGCATGTTTACAGATTCTGG - Intergenic
1123759127 15:23419241-23419263 ATTACCACTTTCACAGGTTCTGG - Intergenic
1124123165 15:26909809-26909831 GGTAGCATACTCACAGGTTTGGG + Intronic
1124159545 15:27255976-27255998 AATAACATAGACACAGGTTCTGG - Intronic
1124205036 15:27710693-27710715 GGTAACATATTCACAGGTTCTGG - Intergenic
1124694759 15:31854731-31854753 GGTAACATATTCACAGGTTTGGG + Intronic
1124839164 15:33225844-33225866 GGGAACATATTCACATGTTCTGG + Intergenic
1124885454 15:33681468-33681490 GGTAACATATTCATAGGTTCTGG + Intronic
1125144920 15:36455827-36455849 GGTAATATATTCACAGGTTGTGG + Intergenic
1125278043 15:38014171-38014193 GGTAATATATTCATAGGTTCTGG + Intergenic
1125303980 15:38289492-38289514 CCTAACATACTCACAGGTTCTGG - Intronic
1125353147 15:38788789-38788811 AAGAGCACATTCACAGTTTCTGG + Intergenic
1125387304 15:39152005-39152027 AATAACATATTCACAGATCCTGG + Intergenic
1126158387 15:45586388-45586410 GCTAACATATTCACAGCTTCTGG + Intergenic
1126260811 15:46688505-46688527 GGTAACATATTCATAGATTCTGG + Intergenic
1126532055 15:49721459-49721481 GGTAACATATTCACAGGTTCTGG - Intergenic
1126564922 15:50084964-50084986 GGTAATGTATTCACAGGTTCTGG + Intronic
1127176280 15:56361637-56361659 AAGACCATATTCACAGGTACTGG - Intronic
1127706822 15:61555564-61555586 AGTAGAACATTCACAGCTCCAGG + Intergenic
1127802033 15:62485255-62485277 GATAACACATTCACAGGTTCTGG + Intronic
1127880109 15:63149720-63149742 GGTAACATATTCGTAGGTTCTGG - Exonic
1128832077 15:70778668-70778690 GGTAATTTATTCACAGGTTCTGG + Intergenic
1129384440 15:75188193-75188215 AGGAGCACATTCACAAGTACAGG + Intergenic
1130219432 15:82006675-82006697 GGTAATATATTCACAGGTTTAGG - Intergenic
1130221883 15:82026393-82026415 AGTAGCATATTCACATGTTCTGG + Intergenic
1130404325 15:83584402-83584424 AGTAACATATTTGCAGGTTTGGG + Intronic
1130923769 15:88369996-88370018 TATAACATATTCACAGGTTCTGG - Intergenic
1131120015 15:89816184-89816206 CATAACATATTCACAGATTCTGG + Intergenic
1131216854 15:90544390-90544412 AAAGTCATATTCACAGGTTCTGG + Intronic
1131297845 15:91167714-91167736 GGTAACATATTCATGGGTTCTGG + Intronic
1131454504 15:92572551-92572573 CGTGACATATTCACAGGTTCTGG - Intergenic
1131576948 15:93601768-93601790 GGTAACACAGTCACAGGTTCTGG + Intergenic
1131660736 15:94512527-94512549 CCTAACATGTTCACAGGTTCTGG + Intergenic
1131771519 15:95742905-95742927 GGTAACATATTCACAGGTTCCGG + Intergenic
1131853190 15:96564488-96564510 TGTAGCATAGTTACAGGCTCAGG - Intergenic
1131940415 15:97558629-97558651 GGTAATATATTCACAAGTTCTGG + Intergenic
1132155047 15:99489710-99489732 GGTAACATATTCACAGGTTCTGG + Intergenic
1132167170 15:99605378-99605400 TGTAACATATTCACAGGTTCTGG + Intronic
1133407597 16:5537869-5537891 GGTAACATGTTCACAGATTCTGG + Intergenic
1133508421 16:6434260-6434282 GGTAACACATTCAGAGGTTCTGG + Intronic
1133691529 16:8220374-8220396 AATAATATATTCACAGGTTCTGG + Intergenic
1133788757 16:8993034-8993056 GGTAACATATGCACAGGTTCTGG - Intergenic
1133815437 16:9194022-9194044 ACTGACATATACACAGGTTCTGG + Intergenic
1133832153 16:9333189-9333211 TGCAGTATATTCACAGGTTCTGG + Intergenic
1133957234 16:10455147-10455169 GGTAACATATTCACAAGTTCTGG - Intronic
1134085933 16:11357490-11357512 TGTATGATATTCAGAGGTTCTGG + Intergenic
1134238474 16:12486342-12486364 AGTAGCATATTCACAGGTTCTGG + Intronic
1134355609 16:13479320-13479342 GGTAGCATATTCATAGGTCTGGG + Intergenic
1134371824 16:13633109-13633131 GGTAACATATTCACAGGTTCTGG - Intergenic
1134457223 16:14403627-14403649 ATTAGCACTTTCACGGGTTCTGG + Intergenic
1134872845 16:17667336-17667358 AGTAACATATTCACAGGTTCTGG + Intergenic
1135085040 16:19468507-19468529 AGTTACATATTCACCAGTTCTGG - Intronic
1135121620 16:19771063-19771085 AGGTAAATATTCACAGGTTCTGG + Intronic
1135463172 16:22662580-22662602 GGTTACATGTTCACAGGTTCTGG + Intergenic
1135726486 16:24857826-24857848 AACAACATATTCACAGGTTCTGG + Intronic
1135754195 16:25082933-25082955 TCTAACACATTCACAGGTTCTGG - Intergenic
1136720537 16:32316440-32316462 AGGAACATAGTCACAGATTCTGG + Intergenic
1136725597 16:32354832-32354854 AGGAACATAGTCACAGATTCCGG + Intergenic
1136838917 16:33522722-33522744 AGGAACATAGTCACAGATTCTGG + Intergenic
1136843925 16:33560894-33560916 AGGAACATAGTCACAGATTCCGG + Intergenic
1137427531 16:48392117-48392139 AGTAATTTATTCACAGGTTCTGG - Intronic
1137525957 16:49236521-49236543 CCTAGTATATTCACAGGTTCTGG - Intergenic
1138210429 16:55158526-55158548 GGTAACATAATCACAGGCTCAGG + Intergenic
1138487622 16:57356939-57356961 GGTAACATATTCATAGGTTTTGG + Intergenic
1138620024 16:58203552-58203574 GGTAACATATTTACAGATTCTGG - Intergenic
1139056968 16:63197395-63197417 TGTAACAAATTTACAGGTTCAGG - Intergenic
1139065589 16:63309765-63309787 TATAGCATATTTATAGGTTCTGG - Intergenic
1139562477 16:67752171-67752193 GGTGACATAGTCACAGGTTCTGG - Intronic
1139661183 16:68421861-68421883 AGTAGCATATTCACCAGTTCTGG - Intronic
1140335604 16:74102408-74102430 TGTAACATCTTCACAGGTTCTGG - Intergenic
1140342646 16:74180303-74180325 AGTCACATATTCACTGGTTCTGG - Intergenic
1140414889 16:74767424-74767446 GGTAGCATATTCACAGATTGTGG - Intronic
1140511395 16:75511112-75511134 TGTAACCTATTCACAGGTTTTGG - Intergenic
1140619279 16:76708278-76708300 GGTGGCATATTCACAGGTTCTGG - Intergenic
1140632081 16:76865194-76865216 GGTAACATAATCACAGATTCTGG + Intergenic
1140642371 16:76991115-76991137 GGTAACACATTCACAGGTTCTGG + Intergenic
1140743704 16:77963191-77963213 GGTACCAGATTCACAGGTTCTGG - Intronic
1140859554 16:79006995-79007017 CCTAACATATTCACAGGTTCTGG + Intronic
1140934971 16:79661992-79662014 TATAACATATTCACAGGTTCTGG + Intergenic
1140987625 16:80173724-80173746 AGTAGTATCTTCCAAGGTTCTGG - Intergenic
1141001793 16:80315222-80315244 AGGTACATATTCACAGGTTCTGG + Intergenic
1141269220 16:82523502-82523524 GGTAACATCTTCACAGATTCTGG + Intergenic
1141277011 16:82597475-82597497 TATAACATATTCACAGGTTTTGG - Intergenic
1141304389 16:82847645-82847667 TCTAACATATTCACAGGTCCTGG + Intronic
1141372669 16:83502139-83502161 GGTAACATATTTACAAGTTCTGG - Intronic
1141510620 16:84509635-84509657 GGTAACATATGCGCAGGTTCTGG - Intronic
1141920010 16:87129339-87129361 AGTAACATGTTCATAGATTCTGG + Intronic
1203000835 16_KI270728v1_random:162922-162944 AGGAACATAGTCACAGATTCTGG - Intergenic
1203005895 16_KI270728v1_random:201330-201352 AGGAACATAGTCACAGATTCTGG - Intergenic
1203132436 16_KI270728v1_random:1699327-1699349 AGGAACATAGTCACAGATTCCGG - Intergenic
1203149080 16_KI270728v1_random:1823009-1823031 AGGAACATAGTCACAGATTCTGG + Intergenic
1203154090 16_KI270728v1_random:1861193-1861215 AGGAACATAGTCACAGATTCCGG + Intergenic
1142599022 17:1044052-1044074 ATTAGCATATTCCCAGGGTCCGG - Intronic
1142996917 17:3765969-3765991 GGCAACATATTCACAGGTTCTGG - Intronic
1143304554 17:5935830-5935852 ACTAACTTATTCACAGGTTCTGG + Intronic
1143348213 17:6266112-6266134 GGTAACATATTCACAGGGTCTGG + Intergenic
1143353809 17:6309434-6309456 AGCAACATATTCACAGGTTCCGG - Intergenic
1143367963 17:6420718-6420740 AGTAACCTATCCACAGGCTCTGG - Intronic
1144688085 17:17239667-17239689 AGTAACATATCCAGAGCTTCTGG - Intergenic
1147485101 17:40805235-40805257 GGTAATGTATTCACAGGTTCTGG - Intergenic
1147583819 17:41641227-41641249 AGGTGCATATTTCCAGGTTCTGG - Intergenic
1148231556 17:45938560-45938582 AGTGACATATTCACAGGTTCTGG + Intronic
1148251983 17:46089987-46090009 AAGGTCATATTCACAGGTTCTGG - Intronic
1148397085 17:47317657-47317679 GGTAACATATTCACAGGTTCTGG - Intronic
1148679284 17:49464435-49464457 AGTAACATATTCACAGGTTCTGG + Intronic
1148841595 17:50502229-50502251 GGTAACATATTTACAGCTTCCGG + Intergenic
1148964882 17:51426802-51426824 AGCAACATGTTCACAGGTTCTGG - Intergenic
1148993163 17:51683991-51684013 GGCAACATTTTCACAGGTTCTGG - Intronic
1149272423 17:54994769-54994791 AGTAGCATTTTCTCAGTTCCTGG + Intronic
1149445337 17:56708805-56708827 GGTAACAGATCCACAGGTTCTGG - Intergenic
1149552406 17:57549996-57550018 AGCAGCATCTTCACAGGCTGTGG + Intronic
1150097610 17:62391545-62391567 GATAGCATATTCACTGGTTAAGG + Intronic
1150706546 17:67492206-67492228 AAGATCATATTCACAGGCTCTGG - Intronic
1150919605 17:69469370-69469392 GGTAACATATTCACAGAATCTGG + Intronic
1151009254 17:70474435-70474457 AGTAGCATCTGCTCAGTTTCTGG + Intergenic
1151035797 17:70797591-70797613 GGTAACACATTCACAGGTTCTGG + Intergenic
1151088996 17:71413705-71413727 GGTAACCTATTCACAGGTTCTGG + Intergenic
1151106692 17:71623823-71623845 AGTAATATATTCACAGGTTCTGG - Intergenic
1151410135 17:73919713-73919735 AAGGTCATATTCACAGGTTCTGG - Intergenic
1151581912 17:74984459-74984481 GGTAACATATTCAGAGATTCTGG - Intergenic
1152174600 17:78779512-78779534 GGTAACCTATTCACAAGTTCTGG - Intronic
1152960428 18:76550-76572 AGTGGCATAATCACAGCTCCTGG + Intergenic
1153321810 18:3780675-3780697 TGTAACATATTCACAGGTTCCGG + Intronic
1153435219 18:5061746-5061768 GGTATCATAGTCACAGATTCTGG + Intergenic
1153780504 18:8491340-8491362 AGTAACATATTCACAGGTTCTGG - Intergenic
1153842391 18:9018547-9018569 AGTAACAAATTAATAGGTTCTGG - Intergenic
1153940510 18:9972747-9972769 TCTAACGTATTCACAGGTTCCGG - Intergenic
1154055814 18:11013109-11013131 AGTAACATATTCACAGGTTCTGG - Intronic
1154074556 18:11187586-11187608 CCCAACATATTCACAGGTTCTGG - Intergenic
1154088074 18:11326941-11326963 GGTAACATATTCATAGGTTCTGG - Intergenic
1154272384 18:12931385-12931407 AGTAACCTATTCACAGGTCCTGG + Intergenic
1155254131 18:23979793-23979815 GATAACATAGTCACAGGTTCTGG - Intergenic
1155256621 18:24003397-24003419 ACTAGAAGATTCTCAGGTTCAGG + Intronic
1155341052 18:24814505-24814527 GGTAACATATTGACAGGTTCTGG + Intergenic
1155462192 18:26095380-26095402 CCTAACATAATCACAGGTTCTGG - Intergenic
1155575270 18:27238844-27238866 GATAACATATTCACAGGATCTGG + Intergenic
1155793992 18:30010703-30010725 AGCAACAAATTCACAGGTTCTGG - Intergenic
1155927624 18:31673765-31673787 AGTGTCACATTCACAGGTTCTGG - Intronic
1156032463 18:32728548-32728570 AATATCATGTTCACAGGTACTGG - Intronic
1156509769 18:37626578-37626600 GGGAACATATTCACAGGTTTGGG + Intergenic
1156535173 18:37856109-37856131 TGTAGAAGATTCATAGGTTCAGG + Intergenic
1156757979 18:40551631-40551653 TGTAACATATTCATAGGTTATGG + Intergenic
1157054840 18:44214687-44214709 TGTAACACATTCACAGGTTCTGG - Intergenic
1157521795 18:48350531-48350553 GGCAACATACTCACAGGTTCTGG + Intronic
1157881925 18:51328925-51328947 CATACCCTATTCACAGGTTCTGG + Intergenic
1157900782 18:51514687-51514709 CTTAACATATTCACAGGTTCCGG - Intergenic
1158160365 18:54475720-54475742 GGGAACATATTCACAGGTTCAGG - Intergenic
1158839439 18:61368233-61368255 CATAACATATTCACAGGTTCTGG + Intronic
1159112067 18:64070811-64070833 GGTGACATATTCACAGGTTGTGG + Intergenic
1159192068 18:65059493-65059515 AGTAGCATATTATTAGGTTTTGG + Intergenic
1159452835 18:68624367-68624389 GGTAGCATAGTCACAGCTTTTGG - Intergenic
1159972559 18:74671753-74671775 GGAAGCATATTCACAGGTTCTGG + Intronic
1163016460 19:14458388-14458410 AGAAGCATTTTCTCAGGGTCAGG - Intronic
1163753417 19:19092249-19092271 AGCGTCACATTCACAGGTTCTGG + Intronic
1164424959 19:28133080-28133102 GGTGACATAGTCACAGGTTCAGG - Intergenic
1164505209 19:28854567-28854589 GGTAACACAATCACAGGTTCTGG - Intergenic
1164787355 19:30944137-30944159 GGTACCATTTTCACAGGTTCTGG - Intergenic
1166031716 19:40136114-40136136 TGCAGTATATTCCCAGGTTCTGG - Intergenic
1166185870 19:41138468-41138490 AATATCACATTCACAGGTCCTGG + Intergenic
1166848709 19:45746890-45746912 GGCAACATATTCATAGGTTCTGG + Intronic
1167490589 19:49790697-49790719 GGGAATATATTCACAGGTTCTGG - Intronic
1168714816 19:58520461-58520483 ATAATCATATTTACAGGTTCTGG - Intronic
925435437 2:3833294-3833316 CCTAACATAGTCACAGGTTCTGG + Intronic
926339676 2:11894747-11894769 AGTAACAGATGCACAGGCTCTGG + Intergenic
926574399 2:14564217-14564239 GATAACATATTCACAGGTTCCGG - Intergenic
926576320 2:14586223-14586245 GGTAACATTTTCACAGATTCTGG - Intergenic
926656112 2:15408136-15408158 GGTAACATCTTCATAGGTTCAGG + Intronic
926821077 2:16852198-16852220 GGTAACATATGCACAGTTTCTGG + Intergenic
927191633 2:20521017-20521039 AAGATCGTATTCACAGGTTCTGG - Intergenic
927446313 2:23165185-23165207 ATAAGCATATACACAGGATCAGG + Intergenic
927523718 2:23719018-23719040 AACAACATATTCACAGGTTCTGG + Intergenic
927710320 2:25321530-25321552 GGTGACATATTCACAGGTCCAGG + Intronic
927728030 2:25443318-25443340 AGGAGCATTCTCTCAGGTTCAGG + Intronic
927818188 2:26239373-26239395 CCTAACATATTCACAGGTTCTGG - Intronic
928721030 2:34121573-34121595 GGTAACACATTCACAGGTTCTGG - Intergenic
928777352 2:34781501-34781523 GGTAACATATTGACAGATTCTGG - Intergenic
929089299 2:38198939-38198961 AGTAACATTTGGACAGGTTCAGG - Intergenic
929123603 2:38503263-38503285 AGTAACATTTTCACATGTTCTGG + Intergenic
929259094 2:39844902-39844924 AGTAACATATTCACGGGGCCTGG + Intergenic
929323849 2:40581217-40581239 GGTAACATATTCACAGGGTCTGG + Intronic
930035369 2:47082026-47082048 GGTAACATATTCACAGGTTCTGG - Intronic
930301556 2:49622085-49622107 AGTAATATATTCACAGGTTCTGG - Intergenic
930322448 2:49873725-49873747 AATAACATATTCACAAATTCTGG - Intergenic
930561277 2:52962477-52962499 AGTAGCAAGTACAAAGGTTCTGG - Intergenic
930898821 2:56479438-56479460 GGTAATATATTCACAGGTTCTGG - Intergenic
931049440 2:58394184-58394206 GGTAACATATTAACAGGTTCTGG - Intergenic
931095736 2:58938742-58938764 TGTAACATATTCATAGGCTCTGG - Intergenic
931451518 2:62370962-62370984 GGTAACATATTCACAGGTTTGGG - Intergenic
931687463 2:64806753-64806775 TGTATTATAGTCACAGGTTCTGG - Intergenic
932281301 2:70494307-70494329 GGTAGCATAGTCAGAGTTTCTGG + Intronic
932376083 2:71237177-71237199 GTTAACATATTCATAGGTTCTGG + Intergenic
933027548 2:77279994-77280016 ACTAGCATGGTCATAGGTTCTGG - Intronic
933150520 2:78909546-78909568 GGTAACATAGTCTCAGGTTCTGG - Intergenic
933627045 2:84612832-84612854 ACTAACATATCCACAGGTTTGGG + Intronic
934082722 2:88483225-88483247 GGTAGCATATTCGTAGCTTCTGG + Intergenic
934688426 2:96338482-96338504 GATAACATATTCACAGGTTCTGG - Intronic
934808665 2:97262863-97262885 AGTGGCATCTGCACAGCTTCTGG - Intronic
934828844 2:97494327-97494349 AGTGGCATCTGCACAGCTTCTGG + Intronic
935296764 2:101656516-101656538 TGTAACAAATTCACAGGTTCTGG - Intergenic
935386915 2:102509448-102509470 ACTACCATATTCACAAGTTCTGG + Intronic
935485375 2:103646835-103646857 AGTAACATATTCATGGGTCCTGG - Intergenic
935621843 2:105136783-105136805 CGTAACATATTCACAAGTTCCGG + Intergenic
935679646 2:105624864-105624886 AGGAACATACTCACAGGTTTTGG + Intergenic
935933792 2:108158867-108158889 ATTGACATATTCACAGGATCTGG - Intergenic
935939096 2:108220089-108220111 ACAAACATATTCACAGGTTCTGG + Intergenic
936135335 2:109888203-109888225 AGTAACATATTCACAGGTTTTGG - Intergenic
936209362 2:110483282-110483304 AGTAACATATTCACAGGTTTTGG + Intergenic
936428548 2:112438521-112438543 AGTAACATATTCACAGGTTTTGG + Intergenic
936485271 2:112920031-112920053 TGTAACATATACACAGGGTCTGG + Intergenic
936835365 2:116703276-116703298 AGTAGGATTTTCACAAGTTCTGG - Intergenic
936895259 2:117420564-117420586 AGTAATATATTCCCAGGTTCTGG + Intergenic
937281189 2:120718337-120718359 GGTAACTTAATCACAGGTTCAGG + Intergenic
937363532 2:121245008-121245030 GGTGACATATTCACAGGTTCTGG - Intronic
937431505 2:121842580-121842602 AGTAACATATTCACAGGTTCCGG - Intergenic
937621295 2:123990824-123990846 AGTGGCATAGTCATAGGTGCTGG - Intergenic
937791222 2:125964143-125964165 AGGAGCATAGTCACAGATTCAGG - Intergenic
937927633 2:127179431-127179453 TCTAGCGTATTCTCAGGTTCTGG + Intergenic
938173464 2:129103309-129103331 AGCAGCATATTCACATGTTTTGG + Intergenic
938404855 2:131025984-131026006 CATAACATATTCACAGGCTCTGG + Intronic
938710704 2:133974045-133974067 GATAACATAGTCACAGGTTCTGG + Intergenic
938803256 2:134782762-134782784 GGTAACATATTCACAGGTTCTGG + Intergenic
938808915 2:134833761-134833783 AGTAACATATTCACAGGTTCTGG - Intergenic
939389273 2:141545423-141545445 GGTAACATATTCACAGGTTCTGG - Intronic
939462456 2:142514295-142514317 GGTAACATACTCACAGGTTCTGG + Intergenic
939482466 2:142766792-142766814 AGTGGCATCTTCTCAGCTTCTGG + Intergenic
939805151 2:146766665-146766687 CCTAACATATCCACAGGTTCTGG - Intergenic
940208398 2:151230290-151230312 TACAACATATTCACAGGTTCTGG - Intergenic
940329404 2:152458076-152458098 GGTAACATATTCATAGGTTCTGG + Intronic
940557106 2:155243182-155243204 GATAACATATTCACAGGTTCTGG + Intergenic
940570481 2:155426663-155426685 GTTAGCATAGTCACAGGTTCTGG - Intergenic
941097146 2:161251470-161251492 ATTAGCAAATTCACATTTTCTGG + Intergenic
941114234 2:161452944-161452966 GATAACATATTCACCGGTTCTGG + Intronic
941314619 2:163976978-163977000 GGTAATATATTCACAGGTTCCGG - Intergenic
941454916 2:165703684-165703706 GGTAACATGTTCACAGGTTCTGG - Intergenic
941552544 2:166935130-166935152 ATTAGCACAATCACAGCTTCAGG - Intronic
941567175 2:167123832-167123854 ACAAGCATATTCTCAGGTACTGG + Intronic
941573695 2:167203158-167203180 GGTCGCATATTCATAGGTCCTGG + Intronic
941579602 2:167278311-167278333 AATTGTATATTCACAGGTTCTGG + Intergenic
941857875 2:170248838-170248860 CCTAACATATTCACAGGTTCTGG + Intronic
941947334 2:171114274-171114296 GGTAACATAGTCACAGGCTCTGG - Intronic
942493031 2:176508989-176509011 GGTAACATATTCAAAGGTTCTGG + Intergenic
942539673 2:177002485-177002507 GGTAATATATTCATAGGTTCTGG + Intergenic
942542358 2:177027932-177027954 AATAATATATTCACAGGTTTAGG - Intergenic
942944839 2:181660586-181660608 GGTAACATATTCACAGGTTCTGG + Intronic
943197922 2:184779443-184779465 CCTAACATATTCACAGGTTCTGG - Intronic
943388481 2:187231845-187231867 AAGATCACATTCACAGGTTCTGG - Intergenic
943568351 2:189543111-189543133 ATAAGCATATTCCCAGGTTCTGG - Intergenic
943896393 2:193367187-193367209 AGTAACTTATTCACAGGTTCGGG + Intergenic
943996178 2:194768941-194768963 GCTAACATATTCACAGGTTCTGG - Intergenic
943997032 2:194782372-194782394 TGCAACATATTCACAAGTTCTGG - Intergenic
944312043 2:198244334-198244356 AGTCCCACATTCACAGGTTCTGG - Intronic
944365914 2:198919394-198919416 GGTGACATATTCACAGGTTCTGG + Intergenic
944427250 2:199596042-199596064 AATAGCCTATTCACAGCCTCTGG - Intergenic
944429856 2:199621345-199621367 GCCAGAATATTCACAGGTTCTGG - Intergenic
944605589 2:201349078-201349100 AGTAACATATTCACAGTCTCTGG + Intronic
944618169 2:201483819-201483841 CCTAACATATTAACAGGTTCTGG + Intergenic
944903387 2:204238617-204238639 GGTACCATATTCACAGGTCCTGG - Intergenic
944918861 2:204389670-204389692 AGGAGCATATTGAAGGGTTCAGG + Intergenic
944922329 2:204428592-204428614 GGTAACATATTCACAGGCTCTGG - Intergenic
944931885 2:204528359-204528381 GGTAACATATTCACAGGTTCTGG - Intergenic
945082614 2:206101208-206101230 GGTAACATATTCACAGGTTTAGG + Intergenic
945221591 2:207489556-207489578 GGTAACACATTCACTGGTTCTGG + Intergenic
945230193 2:207580235-207580257 AGTAGCATGTTTACAGGTTTTGG - Intronic
945383525 2:209169313-209169335 TGTAACATATTCACAGGTTCTGG - Intergenic
945797028 2:214377869-214377891 AGTAACATATTCTCAAATTCTGG - Intronic
945807727 2:214510861-214510883 GGTAACATAATGACAGGTTCTGG - Intronic
945830293 2:214776712-214776734 GGTAACATAGTCACAGGTTCTGG - Intronic
946038573 2:216764594-216764616 CTTAACATATTCACAGGTTCTGG + Intergenic
946425030 2:219589955-219589977 CATAACATATTCACAGGCTCTGG - Intergenic
946900432 2:224367010-224367032 AAGATCACATTCACAGGTTCTGG - Intergenic
947180379 2:227406088-227406110 AGTACCATCTTCACAAATTCTGG + Intergenic
947258118 2:228189057-228189079 GGTAACATATTCACAGGTTTTGG + Intergenic
947351046 2:229245457-229245479 AGTAGCATCTTCATACCTTCAGG - Intronic
947425931 2:229982846-229982868 GGTCCCATATTCACAGGGTCTGG + Intronic
947944562 2:234090538-234090560 AGTAGCATATTCACAGATTCTGG + Intergenic
948072374 2:235138326-235138348 TGTACCATATTCACAAGTTCCGG - Intergenic
948114280 2:235482636-235482658 AGGTGCATTTTCACAGGTTCTGG - Intergenic
948126642 2:235569034-235569056 GGCAGCGTATTCATAGGTTCTGG + Intronic
948478442 2:238236130-238236152 AGTAGCATATTCGCAGGTTCTGG - Intergenic
1169133400 20:3180209-3180231 AACAACATATTCACAGGTTCTGG - Intergenic
1169401943 20:5289515-5289537 GGTAACATATTGACAGGTTCTGG + Intergenic
1169482693 20:5999700-5999722 CCTAACACATTCACAGGTTCTGG - Intergenic
1169832049 20:9836277-9836299 AACGTCATATTCACAGGTTCTGG - Intronic
1170040952 20:12038701-12038723 AGTAGAATGGTCAGAGGTTCTGG + Intergenic
1170108555 20:12779465-12779487 GGTAACATTTTCACAGATTCAGG + Intergenic
1170391033 20:15874786-15874808 CCTAACATATTCACAGGGTCTGG - Intronic
1170393590 20:15902537-15902559 AGTAGCATATCTTGAGGTTCTGG + Intronic
1171197751 20:23214428-23214450 ACTAACATATTTACAGGTTCTGG - Intergenic
1171200210 20:23234652-23234674 GGTGACATATTCACAGATTCTGG + Intergenic
1171227957 20:23457007-23457029 GGTAACAAGTTCACAGGTTCTGG + Intergenic
1172908980 20:38391926-38391948 GGTAACATACTCATAGGTTCAGG + Intergenic
1173162952 20:40665859-40665881 GGCAACATATTCACAGGTTCTGG + Intergenic
1173190718 20:40873634-40873656 AGTAATATATTCACAGGCTCTGG - Intergenic
1173286622 20:41677609-41677631 AGTACCATAGTCACAGATTTGGG + Intergenic
1173383890 20:42570898-42570920 GGCAACATATTCACAGATTCTGG + Intronic
1173428275 20:42961734-42961756 GGTAGCATATACACAGGTTCTGG - Intronic
1173470905 20:43322890-43322912 GGTACCATATTCACAGGTGCTGG - Intergenic
1173474876 20:43351960-43351982 GGTAGCTCATTTACAGGTTCTGG - Intergenic
1173489889 20:43471277-43471299 AGTTACATATTCACAGGTTCTGG - Intergenic
1173832783 20:46102661-46102683 GGTGACATATTCACGGGTTCCGG - Intergenic
1173888184 20:46480229-46480251 GGTCACATACTCACAGGTTCTGG + Intergenic
1174073636 20:47916552-47916574 TGTAACATAGTCACAGATTCTGG - Intergenic
1174473211 20:50776746-50776768 AAGAGCATATTCACAGGCTCCGG + Intergenic
1174481230 20:50832925-50832947 GGTGACATATTCACAGGTTCTGG + Intronic
1174551000 20:51361663-51361685 AGAACCATATTCACAAGCTCTGG + Intergenic
1174552920 20:51374574-51374596 GGTAACATATTCACAGGTTCTGG + Intergenic
1174689114 20:52485548-52485570 CGTAACATATTCACAGGTTCTGG - Intergenic
1174897112 20:54461678-54461700 AGTAGCATATTAAAATGTCCTGG + Intergenic
1175059185 20:56226362-56226384 GGTAACATATTCATAGGTTCTGG - Intergenic
1175172465 20:57090228-57090250 AGTGACATGTTCACAGGCTCTGG - Intergenic
1175600990 20:60272880-60272902 AGTAGCAGTCTAACAGGTTCCGG - Intergenic
1175774310 20:61643428-61643450 GGTCACAAATTCACAGGTTCTGG + Intronic
1176693487 21:9946296-9946318 AAAAGCATATTCACAGGTAGAGG + Intergenic
1176697737 21:10001147-10001169 ACTAACATATTCACAAATTCTGG + Intergenic
1176924208 21:14727124-14727146 ATTAACATATTCACAGGCTCTGG - Intergenic
1177141538 21:17363046-17363068 AATAACACATTCACAGGTTCTGG - Intergenic
1177315928 21:19461103-19461125 GGTAACATAGTCACAGGTTCTGG - Intergenic
1177710114 21:24762979-24763001 GGTAACATATTTACAGATTCTGG + Intergenic
1177783538 21:25644659-25644681 AGTAAGATATTTATAGGTTCTGG + Intronic
1177802172 21:25838838-25838860 CCTAACATAGTCACAGGTTCTGG + Intergenic
1177920847 21:27150455-27150477 AGTAGTATATTCACAGGTTGTGG + Intergenic
1178065111 21:28895970-28895992 AGCATCATATTCACAGGTTCTGG - Intergenic
1178183514 21:30192256-30192278 GATAACATATTCACAGGGTCTGG + Intergenic
1179154907 21:38841203-38841225 GGCAGCATGTTCACAGGTTCTGG + Intergenic
1179217111 21:39377091-39377113 AGTAACATATTCACATGTGCTGG - Intergenic
1179596800 21:42448431-42448453 AGTTGCATATTCCCAGGTCCCGG + Intergenic
1180308538 22:11149779-11149801 AGGAACATAGTCACAGATTCCGG - Intergenic
1180547015 22:16511592-16511614 AGGAACATAGTCACAGATTCCGG - Intergenic
1181990442 22:26832880-26832902 GATAACATATTCACAGGTTTTGG + Intergenic
1182069084 22:27450788-27450810 GGTAATACATTCACAGGTTCTGG - Intergenic
1182127375 22:27825870-27825892 GGTAACATAGTCACAGGTCCTGG + Intergenic
1182249192 22:28986150-28986172 GGTAACTTATGCACAGGTTCTGG + Intronic
1182719530 22:32386276-32386298 GGTGGCATCTTCCCAGGTTCTGG + Intergenic
1182924619 22:34110600-34110622 GGTAGCATATTTACAGGTTCTGG + Intergenic
1183039984 22:35170761-35170783 AGTGACATATTCGCAGGTTCTGG - Intergenic
1183068132 22:35377801-35377823 GGTAACCTATTCACAGGTTCTGG + Intergenic
1183125145 22:35771120-35771142 GGTAACATATTCACTGGCTCTGG - Intronic
1183514875 22:38259330-38259352 GGTAGCATGTTCACAGGCTCTGG - Intronic
1183607558 22:38874896-38874918 GGTATCCTATCCACAGGTTCTGG + Intergenic
1185360699 22:50405011-50405033 AGTACCTTATTCACAGGTGTTGG + Intronic
949392631 3:3579387-3579409 TGTAACATATTCCCAGGTTCTGG + Intergenic
949420699 3:3862835-3862857 GGTAATATATCCACAGGTTCTGG - Intronic
949852182 3:8430426-8430448 GGTAACAAAATCACAGGTTCTGG - Intergenic
950073409 3:10170380-10170402 GGTACCATATTCACAGGTCTCGG + Intronic
950832096 3:15885144-15885166 GGTAACATATTTATAGGTTCTGG - Intergenic
951099382 3:18668978-18669000 GGTAACACATTCACAGGTTCTGG + Intergenic
951397528 3:22187935-22187957 TTTGCCATATTCACAGGTTCTGG - Intronic
951606574 3:24441270-24441292 ATTATCATATTCACAGGTCCAGG + Intronic
951704589 3:25530757-25530779 CATAACATATTCACAGCTTCTGG + Intronic
951820037 3:26798143-26798165 GGTAACATATTCACAGATCCTGG - Intergenic
951945126 3:28127165-28127187 CATAGCATATTCACAGATTCTGG - Intergenic
951994137 3:28707991-28708013 CCTAACATACTCACAGGTTCTGG + Intergenic
952082065 3:29771502-29771524 CCTAACATATTTACAGGTTCTGG - Intronic
952258048 3:31712345-31712367 AGTGCCGTATACACAGGTTCCGG - Intronic
952397749 3:32935933-32935955 AGAAACACATTCACTGGTTCTGG - Intergenic
952475685 3:33707934-33707956 GATACCATATTCAGAGGTTCTGG - Intronic
952518431 3:34129483-34129505 GATAACATATTCACAGGTTCTGG + Intergenic
952966574 3:38624611-38624633 ATTAGCATATTCACAGTTTCCGG - Intronic
953519419 3:43627148-43627170 AGTACCAGATTCCCAGTTTCAGG + Intronic
953760493 3:45683196-45683218 AATAAGATATTCACAGGTTCTGG + Exonic
953857495 3:46511240-46511262 GGTTACATGTTCACAGGTTCTGG - Intergenic
953900911 3:46843366-46843388 AGTAACATATTCACAGATTTTGG - Intergenic
954577095 3:51682486-51682508 AGCTGCATATTCAGAGGTTTGGG + Intronic
955124626 3:56098970-56098992 AAGATCACATTCACAGGTTCTGG - Intronic
955137486 3:56234011-56234033 AATAACATAATCACAGGTTTTGG + Intronic
955142139 3:56279935-56279957 AGTAACATATACACAGGATTTGG - Intronic
955234085 3:57124296-57124318 AATAGCATACTCACAGGTTCTGG - Intronic
955639660 3:61068613-61068635 GATAGTATATTCACAGGTTCTGG + Intronic
955896594 3:63707099-63707121 GGTAACATATTCCCAGGTTTTGG + Intergenic
956102393 3:65782158-65782180 TGTAACATAGTCACAGGTTCTGG - Intronic
956196483 3:66657921-66657943 GATAACATATTCACAGGTTCTGG + Intergenic
956229047 3:66992513-66992535 GATAACATAGTCACAGGTTCTGG + Intergenic
956662615 3:71614120-71614142 AGTAGAATATTCACAGGTTCTGG + Intergenic
956736754 3:72244342-72244364 ACCAACATATTCACAGGTCCTGG + Intergenic
956775496 3:72562034-72562056 GAAAACATATTCACAGGTTCTGG - Intergenic
956860631 3:73320415-73320437 TGTAACATATTCACAGGTTCAGG + Intergenic
957248759 3:77746035-77746057 AGTAACATATTGACAACTTCTGG + Intergenic
957935717 3:86939279-86939301 AGTAACATATTCAATGGTTCTGG - Exonic
958009445 3:87857836-87857858 GGTAACATATTCACAGGCTCTGG + Intergenic
958009938 3:87864208-87864230 TTTAACATATTCACAGTTTCTGG + Intergenic
958271781 3:91508807-91508829 ATGAGCATATTTACAGGTTAAGG - Intergenic
958739803 3:98055754-98055776 CCTAACATATTCACAGGTTCTGG + Intergenic
958860718 3:99442311-99442333 TGTAACATATTCACAGGTTCTGG + Intergenic
959167067 3:102793765-102793787 GGTAACATATTTACAGGTTCTGG - Intergenic
959192685 3:103135253-103135275 GGTAAAATATCCACAGGTTCTGG + Intergenic
959478754 3:106845549-106845571 TGTATCATATTCACAGTTCCTGG - Intergenic
959597659 3:108145646-108145668 AAGGGCACATTCACAGGTTCTGG - Intergenic
959794948 3:110415276-110415298 GGCAACATACTCACAGGTTCTGG - Intergenic
959967548 3:112373895-112373917 AATATCATATTCATAGGTTCTGG - Intergenic
960085884 3:113590922-113590944 GGTAACATATTCACAGGTTCTGG - Intronic
960556853 3:119039532-119039554 GGTAATATATTCACAGGTTCTGG + Intronic
960636972 3:119793752-119793774 GGAAACATATTCACATGTTCTGG + Intronic
960695340 3:120390330-120390352 AGTGGCATATGCAGAGATTCAGG - Intergenic
960704873 3:120472337-120472359 AGTAACACATTCACAGGTTTGGG - Intergenic
961143612 3:124575905-124575927 GGTAACATATTTATAGGTTCTGG + Intronic
961354013 3:126322598-126322620 AGTAACATCTTCCCAGGTTCTGG + Intergenic
961611515 3:128143518-128143540 GGTAACATATTCACTGGCTCCGG + Intronic
961669189 3:128516742-128516764 GGTGACATAGTCACAGGTTCTGG - Intergenic
962148001 3:132861472-132861494 CATAATATATTCACAGGTTCTGG - Intergenic
962446400 3:135469694-135469716 GTTAACATATTCACAGGTGCAGG - Intergenic
963002485 3:140695308-140695330 CCTAACATATTCAAAGGTTCTGG + Intronic
963169797 3:142239504-142239526 GGCAACACATTCACAGGTTCTGG - Intergenic
963204535 3:142618908-142618930 CATACCATATTCACAGGTTCTGG + Intronic
963371117 3:144401750-144401772 ACTATCATATTCACAGATTATGG + Intergenic
963412029 3:144940803-144940825 AGCAACATATCCACAGGTTCTGG + Intergenic
963639724 3:147843779-147843801 GGTAGCGTAGTCACAGGTTCTGG - Intergenic
963713102 3:148770059-148770081 GGTAACATATTCATAGGTTCTGG + Intergenic
964143791 3:153434121-153434143 GGCAATATATTCACAGGTTCTGG + Intergenic
964395811 3:156244460-156244482 AGCAACATATTCATAAGTTCTGG + Intronic
964509194 3:157431591-157431613 CATAACATGTTCACAGGTTCCGG + Intronic
964723834 3:159794086-159794108 AGTAGCATATTCACAGGTTCTGG + Intronic
964781258 3:160340829-160340851 GGTAACACATTCACAGGTTCTGG + Intronic
965056651 3:163725668-163725690 GGTAAAATAATCACAGGTTCTGG + Intergenic
965348042 3:167576463-167576485 GATAACATATTCACAGGTTCTGG - Intronic
965368770 3:167834169-167834191 AGAAGCATATTTAAATGTTCAGG - Intergenic
965420693 3:168454928-168454950 AAGGTCATATTCACAGGTTCTGG + Intergenic
965555963 3:170018678-170018700 GGTAACATATTCATAGGTTCTGG + Intergenic
966246451 3:177813295-177813317 GGTAACATATTCACAGGTTCTGG - Intergenic
966427012 3:179790467-179790489 AGTAACATATTCACAGATTTTGG + Intergenic
966435951 3:179884197-179884219 GGTAACATATTTACAGGTTCTGG - Intronic
966562619 3:181340582-181340604 AGTAACAAATTTACAGGTTTTGG - Intergenic
966644325 3:182226381-182226403 TGTATCATAGTCACAGTTTCAGG + Intergenic
966951288 3:184820506-184820528 AGTAACATATTCATGGTTTCTGG + Intronic
966990455 3:185224957-185224979 CATAATATATTCACAGGTTCTGG + Intronic
967234571 3:187371693-187371715 AGTAACATGTTTACAGGTTCTGG - Exonic
967279134 3:187805428-187805450 TATAACATATTCACAAGTTCAGG - Intergenic
967311756 3:188112841-188112863 CATAACATTTTCACAGGTTCTGG + Intergenic
967628671 3:191716456-191716478 AATCACATATTCACAGGTTCAGG + Intergenic
967629251 3:191724110-191724132 GGTAGCATATCCACAGGTAAAGG + Intergenic
969496122 4:7527261-7527283 GGTAGCATAGTCACAGTTTCCGG - Intronic
969588413 4:8107723-8107745 GAAAGCATATGCACAGGTTCCGG - Intronic
969847911 4:9934082-9934104 CCTAACATATTCACAGGTTCTGG + Intronic
969917592 4:10505820-10505842 GGTGACATATTCATAGGTTCTGG + Intronic
970008995 4:11437969-11437991 AGGAACATATTCATAGGTTCTGG - Intergenic
970176621 4:13346061-13346083 GGTAACATATTCACACGTTCCGG - Intergenic
970580013 4:17466567-17466589 GGTGCCATATTCACAGGTTCCGG - Intronic
970734294 4:19148153-19148175 GGTAACATATTCACAGGTTTTGG + Intergenic
970893926 4:21079621-21079643 CATAACATATTCACAGGGTCTGG - Intronic
971014895 4:22478601-22478623 AGTTTCACATTCACAGGTTCCGG - Intronic
971087250 4:23292992-23293014 AAGGTCATATTCACAGGTTCTGG + Intergenic
971106530 4:23530936-23530958 AGTAGCATAATCACACATTGTGG - Intergenic
971532026 4:27701097-27701119 GGTAACAAATTCACAGGTTCTGG - Intergenic
971803311 4:31320601-31320623 TATAACATATTCACAGGTTCTGG - Intergenic
971813662 4:31460621-31460643 GGTAACATATTCACAGGTTTGGG - Intergenic
971935341 4:33140437-33140459 AATATCATATTCATAGGTTCTGG + Intergenic
972297780 4:37756752-37756774 GGTGACATATTCACAGGTTCTGG - Intergenic
972791528 4:42375727-42375749 GGTAACATAGTCACAAGTTCTGG + Intergenic
972831501 4:42819355-42819377 AGTAGCAAATGCAAAGGCTCTGG + Intergenic
973121623 4:46527680-46527702 GGTAGTCTATTCACAAGTTCTGG - Intergenic
974146132 4:57949689-57949711 TATAACATATTCACAGATTCTGG - Intergenic
975600385 4:76093642-76093664 AATAACATATTCACAGGTTCTGG + Intronic
975954748 4:79824350-79824372 CTTAACATAGTCACAGGTTCTGG - Intergenic
976037074 4:80836698-80836720 AGTGACATATTTAGAGGTTCTGG + Intronic
976348011 4:84027486-84027508 GGTAACGTATTCACAGGTTTTGG + Intergenic
976763957 4:88579720-88579742 AAAAACATATGCACAGGTTCTGG - Intronic
976798418 4:88959785-88959807 AGTAACATATTTACAGGTTCTGG + Intronic
976831418 4:89318969-89318991 AATAACATATTCACAGGCTCTGG + Intergenic
976962595 4:90997487-90997509 AGTAACATATTTACAGCTTCTGG + Intronic
977239326 4:94547585-94547607 TGTAACATATTCATAGGTTCTGG + Intronic
977535496 4:98252371-98252393 GGTGCCATATTCACAGGGTCTGG - Intergenic
977657905 4:99543975-99543997 CTTAACATATTCAAAGGTTCTGG + Intergenic
978103758 4:104876065-104876087 CATAACATATTCACAGGTTCTGG - Intergenic
978166489 4:105614787-105614809 AGCAGCATATTCACAAGATTTGG + Intronic
978447783 4:108797146-108797168 CACAACATATTCACAGGTTCTGG - Intergenic
978644883 4:110918546-110918568 AAGATCACATTCACAGGTTCTGG + Intergenic
978661015 4:111126412-111126434 GGTAGCATATTCACATTTCCAGG - Intergenic
978941134 4:114437101-114437123 GGTAACATATTCACAGATTCTGG - Intergenic
978968730 4:114775353-114775375 AGCAGCATCTTCTCAGCTTCTGG - Intergenic
979672700 4:123377466-123377488 CATAACATATTCGCAGGTTCTGG + Intergenic
980252031 4:130329536-130329558 TGTAACGTATTTACAGGTTCCGG - Intergenic
980761008 4:137234175-137234197 AATGGCATATTCACAGGTTCTGG + Intergenic
981116157 4:140993450-140993472 GGTAATGTATTCACAGGTTCTGG + Intronic
981356476 4:143795028-143795050 AACAACATATTCACAGGTTCTGG + Intergenic
981368008 4:143925622-143925644 AACAACATATTCACAGGTTCTGG + Intergenic
981377802 4:144035901-144035923 AACAACATATTCACAGGTTCTGG + Intergenic
981605478 4:146535995-146536017 AGTAGCATATTCATAGGTACTGG + Intergenic
981701324 4:147610189-147610211 GGTAACATATGCACAGTTTCTGG - Intergenic
982030691 4:151297767-151297789 AGTAACATATTCACAGATTCTGG - Intronic
982405441 4:155014996-155015018 AGTAACATATACGCAGGTTCTGG + Intergenic
982431262 4:155324412-155324434 CCTTGCATATTCACAGTTTCTGG - Intergenic
982438198 4:155401715-155401737 GTTAACACATTCACAGGTTCTGG - Intergenic
982587798 4:157264596-157264618 CCTAGCATATTCACAGGTTTTGG + Intronic
982650369 4:158080816-158080838 GGTAACATATTCATAGGATCTGG + Intergenic
982650598 4:158083491-158083513 AGGATCATATTCACAGGTGGTGG + Intergenic
982831245 4:160063389-160063411 GGTAACATAATCACATGTTCTGG + Intergenic
982858016 4:160409910-160409932 ATTAGCATACTCACAGGTTCTGG - Intergenic
982995988 4:162346442-162346464 AGTAACAAATTCACAGGTTCTGG - Intergenic
983090648 4:163497777-163497799 GGTAATATATTCCCAGGTTCTGG + Intronic
983610974 4:169644709-169644731 GGTAACATATTTACAGGTTTTGG - Intronic
983815405 4:172120567-172120589 AGTAACATATTGATAGGTTCTGG + Intronic
984218901 4:176948973-176948995 GATGACATATTCACAGGTTCTGG - Intergenic
984352658 4:178614981-178615003 TATAACATATTCACAGGTTCTGG - Intergenic
984552954 4:181182517-181182539 GGTGGCATATTCATAGGTTCCGG - Intergenic
985522765 5:386330-386352 AGTGACATATTCACAGACTCTGG - Intronic
986140300 5:5024098-5024120 AAGAGCACATTCACAGGTACTGG - Intergenic
986244308 5:5991422-5991444 GGTAACATAGTCACAGATTCTGG - Intergenic
986752100 5:10796421-10796443 GTAAGCATATTGACAGGTTCAGG + Intergenic
986775245 5:11008220-11008242 GGTAGCATATTCACCGGTTCTGG - Intronic
987263701 5:16229395-16229417 AGTAACAGGTTCCCAGGTTCTGG + Intergenic
987385448 5:17324886-17324908 AGTAACATATTCACAGATTCTGG - Intergenic
987485287 5:18518589-18518611 AACAACATATTCACATGTTCTGG - Intergenic
987550110 5:19368695-19368717 CCTAGCATACCCACAGGTTCTGG - Intergenic
987736295 5:21847712-21847734 TATAACATATTCACAGGTCCTGG + Intronic
987962726 5:24831379-24831401 GGTAACATATTCACAGATTCTGG - Intergenic
988115922 5:26891253-26891275 AACAACATCTTCACAGGTTCTGG - Intronic
988168568 5:27626001-27626023 GATAACATATTCACAGGTCCTGG - Intergenic
988210897 5:28202073-28202095 CGTATTATATTCACATGTTCGGG + Intergenic
988378261 5:30467810-30467832 CGTAACATATGCACAGGTTCTGG - Intergenic
988638686 5:33016867-33016889 GGTGGCATATTCACAGGTTCTGG - Intergenic
988710416 5:33768883-33768905 TCTAACATATTCACAGATTCTGG - Intronic
988747627 5:34157473-34157495 GGTAGCATATTCACATATTTTGG - Intergenic
988815163 5:34827344-34827366 AGTTTAACATTCACAGGTTCTGG + Intronic
988874068 5:35424585-35424607 CCTAACATATTCACAGGTTCTGG - Intergenic
989243760 5:39230106-39230128 GGTAGCATATTCACAGTTCCTGG - Intronic
989439005 5:41448024-41448046 AGAAGCCTATTCTCAGGCTCTGG + Intronic
990353428 5:54941227-54941249 AGTAGCATATTCACAGCTTCCGG + Intergenic
990516507 5:56535535-56535557 GGTAACATAGTTACAGGTTCTGG + Intronic
990837134 5:60034624-60034646 GGTTACATATTCACAGGTTATGG + Intronic
990851677 5:60211910-60211932 AGTAGCCTATGCACAATTTCAGG - Intronic
991030649 5:62078704-62078726 AGTAGCATATGCACAGGCCCTGG - Intergenic
991064304 5:62409629-62409651 AGTAACATATTCACAGGTTTTGG + Intronic
991469356 5:66951530-66951552 AATAATACATTCACAGGTTCTGG + Intronic
991598723 5:68331301-68331323 CATAACACATTCACAGGTTCTGG - Intergenic
991984015 5:72264485-72264507 AAGATCACATTCACAGGTTCTGG - Intronic
992077724 5:73206582-73206604 GGTAACTTATTCACAGGTTATGG + Intergenic
992324789 5:75650143-75650165 CATAACATATTCACAGGTTCCGG - Intronic
992579762 5:78159706-78159728 GGTAACATATTCACAGGTTCTGG + Intronic
992647838 5:78828772-78828794 CCTAACATATTCACAGGTCCTGG - Intronic
992754585 5:79892347-79892369 TGTAACATATTCACAGGTTCTGG - Intergenic
993091522 5:83432605-83432627 AAGGGCATATTCCCAGGTTCTGG - Intergenic
993282328 5:85940554-85940576 CATACCATATCCACAGGTTCTGG + Intergenic
993342487 5:86741539-86741561 CCTAACATATTCACAGGTTCTGG - Intergenic
993772260 5:91944014-91944036 TGTATCATTTTCATAGGTTCAGG + Intergenic
993884943 5:93405131-93405153 GATATCATATTCACAGGTTCTGG - Intergenic
994048020 5:95330975-95330997 GGTCACATATTCACAGATTCTGG - Intergenic
994089683 5:95799151-95799173 GGCAACCTATTCACAGGTTCTGG - Intronic
994227171 5:97265958-97265980 AGTAACATATTCACAGCTTTTGG + Intergenic
994739046 5:103595319-103595341 GGTAACATATTCACAGATTTGGG + Intergenic
994767416 5:103936364-103936386 AGTAACATATTCATAGGCTCTGG - Intergenic
994774110 5:104022461-104022483 GGTAACATATTCACAGGTTCTGG + Intergenic
994805170 5:104437374-104437396 GTTAACATATTCAAAGGTTCTGG - Intergenic
994918309 5:106007685-106007707 GGTAGCATATTCGTAGGTTCTGG + Intergenic
995201491 5:109429852-109429874 CATAACATATTCATAGGTTCTGG - Intergenic
995387156 5:111600671-111600693 ACTAACCTAGTCACAGGTTCTGG + Intergenic
995405979 5:111796391-111796413 GATAACATACTCACAGGTTCTGG + Intronic
995856723 5:116600598-116600620 GGTAACATATTCACAAGTTTCGG + Intergenic
995955991 5:117776989-117777011 AATAACACATTCACAGGCTCAGG + Intergenic
996387918 5:122928338-122928360 GGTAACATATTCAGAGGTTCTGG - Intronic
996624825 5:125557844-125557866 GATAACATATTCACAGGTTTGGG + Intergenic
996819041 5:127605362-127605384 GGTAACATATTCACAGGTTCTGG + Intergenic
996848609 5:127928566-127928588 AGCAACATATTCAAAGGTTTCGG + Intergenic
996945757 5:129065738-129065760 GGTAACATATTCACAAGTTCTGG - Intergenic
996984227 5:129539148-129539170 GATGGCATATTCACTGGTTCTGG - Intronic
997778635 5:136634724-136634746 AGTTTCAGATTCACAGGGTCCGG - Intergenic
997902289 5:137777980-137778002 GGTAACATATTCATAGGTTCTGG + Intergenic
998322905 5:141249047-141249069 TATAACATATTCATAGGTTCTGG - Intergenic
998878665 5:146625722-146625744 GGTAAGATATTCCCAGGTTCCGG - Intronic
999003964 5:147955562-147955584 GGTAACATATTCTTAGGTTCTGG - Intergenic
999028331 5:148260801-148260823 AGTAGAATAAACTCAGGTTCTGG - Intergenic
999446032 5:151640086-151640108 GGTAACATATTCACAGGTTGGGG + Intergenic
999476835 5:151907958-151907980 ATTAGCATATTCCCAGGCTATGG - Intronic
999684728 5:154091960-154091982 GGTAACACATTCACAGGGTCTGG - Intronic
999718634 5:154381985-154382007 GGTAACATATTCACAGGTTCCGG + Intronic
999837146 5:155386479-155386501 AATAGGATATTCAAAGGTTCAGG - Intergenic
999966544 5:156816344-156816366 TGTAACATATTCACAGATTCTGG - Intergenic
1000094421 5:157958643-157958665 GGTAGCATCTTCACAGATTCAGG - Intergenic
1000241345 5:159411322-159411344 CGTAACATATTCAAAGATTCTGG + Intergenic
1000279230 5:159767846-159767868 GGTAACATATTCACAGGTCCTGG + Intergenic
1000816007 5:165922748-165922770 TGTAACATATTCACCGGTTCTGG - Intergenic
1000895250 5:166847427-166847449 ACTAACATACTCACAAGTTCTGG - Intergenic
1000991331 5:167915053-167915075 GTTAACATATTCACAGGTTCTGG + Intronic
1001172033 5:169428466-169428488 GATAACATATTCACAAGTTCTGG - Intergenic
1001176408 5:169472981-169473003 TGTAACATATTCACAGGTTCTGG + Intergenic
1001307720 5:170587816-170587838 GGTAACATATTCACAGCTTCTGG + Intronic
1002582151 5:180215455-180215477 GGCAACATATCCACAGGTTCTGG - Intergenic
1003249757 6:4415838-4415860 AGTAACATATTCACAGGTTCTGG - Intergenic
1003429367 6:6024933-6024955 AATATCACATTCACAGGTACCGG + Intergenic
1003492939 6:6639772-6639794 GGTAACATATTCACAGTTTCTGG + Intronic
1004136593 6:12973128-12973150 GGTACCATATTCACAGGGTCAGG + Intronic
1004166370 6:13260315-13260337 AGTAGCACATTCACAGTTTAGGG - Intronic
1004576460 6:16900409-16900431 GTTAACATATTCACAGTTTCTGG - Intergenic
1004740970 6:18460454-18460476 GGTAACACATTCACAGATTCTGG + Intronic
1004876662 6:19962466-19962488 GATAACATATTCACAAGTTCAGG - Intergenic
1004985435 6:21077391-21077413 GGTAACATATTCACAAGTTTCGG - Intronic
1005004030 6:21270289-21270311 AAGATCATATTCACAAGTTCTGG + Intergenic
1005204336 6:23383482-23383504 GGTAACATAGTCACAGGTGCTGG + Intergenic
1005252562 6:23964187-23964209 ACTAACGTATTCACAGGTTCTGG + Intergenic
1005446755 6:25931899-25931921 GGTAATATATTTACAGGTTCTGG + Intergenic
1005486829 6:26308591-26308613 GGTAACTTATTCACAGGTTCTGG - Intergenic
1005545127 6:26859825-26859847 AGTAGCATATTCACATATTTTGG - Intergenic
1005902601 6:30230526-30230548 GGTAACATATTCACAGATTCTGG - Intergenic
1006010592 6:31039876-31039898 AGTAACATATTTCCAGGTTCTGG - Intergenic
1006339234 6:33437494-33437516 AAGATCACATTCACAGGTTCAGG + Intronic
1006499965 6:34452066-34452088 CATAACATATTCACAGGTTCTGG + Intergenic
1006757613 6:36430338-36430360 GGTAACATATTCACAGGTTCTGG - Intronic
1006961812 6:37939496-37939518 ATTATCACATTCACAGATTCTGG + Intronic
1008004796 6:46399871-46399893 AAGATCACATTCACAGGTTCTGG + Intronic
1008348538 6:50459776-50459798 GGTAACATATTCACAGATTCTGG + Intergenic
1008492883 6:52104212-52104234 GGTAACCTATTCACAGATTCTGG - Intergenic
1008572686 6:52830420-52830442 AGTCTCATATACCCAGGTTCTGG + Intergenic
1008757539 6:54815609-54815631 GGTAACATATTCTCAGGTTCTGG + Intergenic
1008818841 6:55606718-55606740 AATAACATATTCACAGGTTTTGG - Intergenic
1008983335 6:57512327-57512349 ATGAGCATATTTACAGGTTAAGG + Intronic
1009015917 6:57901447-57901469 GGTAGCATATTCACATATTTTGG - Intergenic
1009171393 6:60405194-60405216 ATGAGCATATTTACAGGTTAAGG + Intergenic
1009231107 6:61062071-61062093 GATAACATATTCACAAGTTCTGG - Intergenic
1009377746 6:62992680-62992702 AGTTGAATATTCACATCTTCAGG - Intergenic
1009742869 6:67770221-67770243 AGTAACATACCCACAGATTCAGG - Intergenic
1009771810 6:68153160-68153182 GGTAACATATTCACAGGTCTGGG + Intergenic
1010111952 6:72247240-72247262 AGCAGCATTTTCAGAGGTTCAGG + Intronic
1010302078 6:74273015-74273037 AGTAACATATTCACAGGTTCTGG + Intergenic
1010511992 6:76731029-76731051 AAGAACATATTCACAGATTCTGG - Intergenic
1010710505 6:79169157-79169179 AGGAACATAGTCACAGGTTCTGG + Intergenic
1010726883 6:79345164-79345186 TGTAACATATTCATAGGTTCTGG - Intergenic
1011110900 6:83835773-83835795 GATAACATATTTACAGGTTCTGG + Intergenic
1011198240 6:84804843-84804865 ATTATCACATGCACAGGTTCTGG + Intergenic
1011476694 6:87755566-87755588 GGTAACATGTTCACAGGTTTTGG + Intergenic
1011753350 6:90475147-90475169 GCTAACATATTCAGAGGTTCTGG + Intergenic
1012013611 6:93825949-93825971 ATTAACATATTCACAGGTTCTGG - Intergenic
1012112515 6:95255359-95255381 AGTAGAATGTTCACAGATACTGG - Intergenic
1012136662 6:95566069-95566091 AGTAACATAGTCACAGGTTTTGG - Intergenic
1012246656 6:96933618-96933640 GGAAGCATATTGACAGTTTCAGG + Intronic
1012352453 6:98269349-98269371 ATCAGAATATTCACAAGTTCTGG - Intergenic
1012471462 6:99576888-99576910 CATAACATATTCACAGGTTCTGG + Intergenic
1012519663 6:100106084-100106106 TGTTTCATATTCACAGGTCCTGG + Intergenic
1012670276 6:102036343-102036365 AGTAACATATTCAAAGGTTCTGG - Intronic
1012745754 6:103086067-103086089 AGTAGCATCTTAACAGTTTATGG + Intergenic
1013303534 6:108826730-108826752 TGTAACATATTCACAGGTTCTGG - Intergenic
1013438261 6:110135617-110135639 TGTAACATATTCATAGATTCAGG - Intronic
1013699594 6:112749033-112749055 AATAGCATACACACAAGTTCTGG - Intergenic
1013776744 6:113687321-113687343 GGTAACATATTCACAGGTTTTGG + Intergenic
1013905387 6:115210935-115210957 TACAACATATTCACAGGTTCTGG - Intergenic
1013955517 6:115836158-115836180 CTTAACATATTCCCAGGTTCTGG - Intergenic
1014217454 6:118766559-118766581 AGAAACATAGTCACAGGTTCTGG + Intergenic
1014402985 6:121014030-121014052 AGTAACATATTCACAGGTACTGG + Intergenic
1014617269 6:123618535-123618557 GGTAACATATTTACAGATTCTGG + Intronic
1014768902 6:125438927-125438949 GGTAGCATATTCTCAGGTTCTGG + Intergenic
1014857503 6:126419950-126419972 GGTAACATATTCACAGGTCTGGG + Intergenic
1014970697 6:127811598-127811620 AGTAACATATTCATAGGTTCTGG + Intronic
1015081597 6:129232687-129232709 GGGAACATATTTACAGGTTCTGG - Intronic
1015353839 6:132253931-132253953 AGTAGCATATTCACAAGTTCTGG - Intergenic
1015635739 6:135272150-135272172 AGTAGCACAATCACAGGTCACGG + Intergenic
1015971719 6:138749152-138749174 GCTAACATATGCACAGGTTCTGG + Intergenic
1016633885 6:146265640-146265662 TGTAGCATTTTCATAGCTTCAGG + Intronic
1016872019 6:148827003-148827025 GGTAATACATTCACAGGTTCTGG + Intronic
1016918990 6:149272692-149272714 GGTAGCATATTCACAGACTTGGG + Intronic
1017519807 6:155191933-155191955 TTTGCCATATTCACAGGTTCTGG - Intronic
1017739890 6:157397663-157397685 GGTAACGTGTTCACAGGTTCTGG + Intronic
1017744009 6:157430709-157430731 CTTAACGTATTCACAGGTTCTGG + Intronic
1017934819 6:158996030-158996052 CATAACATGTTCACAGGTTCTGG + Intronic
1017949698 6:159126374-159126396 ATGAGCATATTCACAGATACTGG + Intergenic
1018392061 6:163348160-163348182 GGTAAGGTATTCACAGGTTCTGG - Intergenic
1018939208 6:168297238-168297260 ACTGACATATTCACAAGTTCTGG - Intronic
1020669983 7:11094557-11094579 GATAACATATTCACAGATTCAGG + Intronic
1021086309 7:16424170-16424192 GGTAACATATTCATAGCTTCTGG - Intergenic
1021876910 7:25058178-25058200 GGTAACATATTCACAGGTTCTGG + Intergenic
1021897711 7:25252879-25252901 TGTCTCATATTCACAGGTTCTGG - Intergenic
1022472173 7:30688735-30688757 AGTGGCTGATTCACAGGGTCAGG - Intronic
1022726936 7:32989791-32989813 GGTAACATACTCACAGGTTCTGG - Intronic
1022790901 7:33688187-33688209 AGTCACATATTCATGGGTTCTGG - Intergenic
1022791257 7:33691593-33691615 AGTCACATATTCAAGGGTTCTGG - Intergenic
1022831573 7:34072686-34072708 AATAACATAGTTACAGGTTCTGG + Intronic
1023019776 7:36001066-36001088 AGTAGCATATTCACAGGTTCTGG - Intergenic
1023381480 7:39612669-39612691 AGTAATATATTCACAGGCTCTGG - Intergenic
1023391463 7:39715203-39715225 AATAACATATCCACAGGTTCTGG - Intergenic
1023451123 7:40286487-40286509 GGTGGCATATTCATAGGTTCTGG + Intronic
1023451342 7:40289102-40289124 GGTGGCATATTCATAGGTTCTGG - Intronic
1023546683 7:41325117-41325139 GGTAACATATTCACAGGTTCCGG + Intergenic
1023617073 7:42030347-42030369 GGTAACCTATTCACAGGTCCTGG + Intronic
1023632426 7:42177645-42177667 AGCAGCTTATTCAAAGGTTATGG + Intronic
1023645141 7:42303958-42303980 CATACCATAGTCACAGGTTCTGG + Intergenic
1023803547 7:43855142-43855164 AGTACCATATTCACAGGTCTGGG + Intergenic
1024438820 7:49390872-49390894 AGTAACATCTTCCCAGATTCGGG + Intergenic
1024909360 7:54427591-54427613 AGTAACATAGTCACAGGTTCTGG + Intergenic
1025046647 7:55697845-55697867 GGTAACATACTCACAGGTTCTGG + Intergenic
1025283297 7:57643574-57643596 AGTAGAAAATGCACAGGCTCAGG - Intergenic
1025625702 7:63219377-63219399 GATAACATATTCACACGTTCTGG + Intergenic
1025656418 7:63523796-63523818 GATAACATATTCACACGTTCTGG - Intergenic
1026189576 7:68112606-68112628 GATAACATATTCACACGTTCTGG + Intergenic
1026652682 7:72229197-72229219 GGTAACAGATTCACAGGTTCTGG - Intronic
1027355771 7:77353469-77353491 AGTAGCATTTGGACAGGTTGAGG + Intronic
1027751879 7:82159448-82159470 ACTAGCTTATTCAGAGATTCAGG + Intronic
1027765794 7:82339816-82339838 AACAACATATTAACAGGTTCTGG - Intronic
1028127760 7:87133827-87133849 AGTAACATCTTTACAAGTTCTGG - Intergenic
1028181312 7:87728725-87728747 AGTAGCATATTTACAAGTCAGGG + Intronic
1028278980 7:88897132-88897154 GGTAACACATGCACAGGTTCTGG - Intronic
1028672553 7:93419963-93419985 AGTAGCATATTGATACATTCAGG - Intergenic
1028956608 7:96700499-96700521 AGTACGATATTCACAGGATATGG - Intronic
1029025922 7:97417027-97417049 TGCAACATATTCACAGATTCTGG + Intergenic
1029031715 7:97475180-97475202 GGTAACATATTCAGAGCTTCTGG - Intergenic
1029906796 7:104100853-104100875 GGCAACATATTCACAGGTTTAGG - Intergenic
1030168124 7:106574804-106574826 GGTAACATATTCACAGATTCTGG - Intergenic
1030240168 7:107313839-107313861 GGTAACATAATCACAGATTCTGG + Intronic
1030426983 7:109390461-109390483 GGTAACATATTCATAGGTTCTGG + Intergenic
1030527097 7:110667416-110667438 TCTAACATATTCACAGCTTCTGG - Intronic
1030944371 7:115698266-115698288 ATTAGAATATACACTGGTTCAGG + Intergenic
1031132040 7:117843866-117843888 GGGAACATATTCACAGGTCCCGG - Intronic
1031167444 7:118246186-118246208 AATAACATATTCCCAGGTTCTGG + Intergenic
1031167472 7:118246530-118246552 AATAACATATTCCCAGGTTCTGG + Intergenic
1031403772 7:121357856-121357878 ATTAGCATATTAGCAGGTTAAGG + Intronic
1031759857 7:125699034-125699056 GGTAGCATGTTCACAAGTTCTGG + Intergenic
1031822128 7:126515871-126515893 TATATTATATTCACAGGTTCTGG + Intronic
1032123611 7:129174752-129174774 GGTAATATATTCACAGGTCCTGG + Intergenic
1032538300 7:132683046-132683068 AGTGACATAGTCACAGATTCTGG - Intronic
1032755793 7:134889510-134889532 ATTAACATGTTCTCAGGTTCTGG + Intronic
1033626130 7:143111331-143111353 GGTAACAGATTCACAGGCTCTGG + Intergenic
1033769312 7:144531038-144531060 AGTAGCATATTGGCAGGTTCCGG - Intronic
1033814752 7:145058058-145058080 GGTAAAATATTCACAGGTTTTGG + Intergenic
1034045037 7:147918879-147918901 AGTAGGACCTTCACAGGTTCTGG - Intronic
1034125865 7:148671110-148671132 GGTAACATATTCCCAGGTCCAGG - Intergenic
1034407867 7:150917221-150917243 AGTAGCGTGTTCACAGGTTTTGG - Intergenic
1034999904 7:155604260-155604282 GGTGACATATTCACAGGTTCTGG - Intergenic
1035139597 7:156745076-156745098 GGTAACATATTCACAAGGTCTGG + Intronic
1035701155 8:1639980-1640002 AGTACCATGGTCACAGGTTCTGG + Intronic
1035966935 8:4203002-4203024 GGAAACATAGTCACAGGTTCTGG - Intronic
1036537320 8:9662901-9662923 GGTAACATAGTTACAGGTTCTGG - Intronic
1037177866 8:15967870-15967892 GGTAATATACTCACAGGTTCTGG + Intergenic
1037218793 8:16490674-16490696 CCTAACATATTCACAGGTTTGGG - Intronic
1037432183 8:18825382-18825404 AGAGTCAGATTCACAGGTTCTGG + Intronic
1037551835 8:19981993-19982015 ATTAACATATTCACAGTTTCTGG + Intergenic
1038035951 8:23686975-23686997 CATAGCATATTCACAGAATCTGG - Intergenic
1038783187 8:30586343-30586365 GGTAACGTATTCACAGGTTCTGG - Intronic
1038783229 8:30586887-30586909 TGTAGTATTTTCACAGGTTCAGG - Intronic
1038813054 8:30871227-30871249 GGTGATATATTCACAGGTTCTGG + Intronic
1038853655 8:31306936-31306958 GTTAACATATTCATAGGTTCTGG - Intergenic
1038966633 8:32580260-32580282 GGTAACATATTCACAGGTTCTGG + Intronic
1039091782 8:33837560-33837582 GGTAGCATATTTAAAGTTTCTGG + Intergenic
1039104467 8:33975097-33975119 TATAACATATTCACAGGCTCTGG + Intergenic
1039128993 8:34239657-34239679 AGTAACACATTCACAAGTTCCGG - Intergenic
1040521581 8:48180793-48180815 CGTCACATATTCACGGGTTCTGG + Intergenic
1041213897 8:55580650-55580672 GATAGCATATTCACATGTTCTGG + Intergenic
1041674716 8:60526570-60526592 GGTAAAATATTCACAGGTTCTGG + Intronic
1042069449 8:64914898-64914920 GGCAACATAGTCACAGGTTCTGG - Intergenic
1042236877 8:66622002-66622024 GGTAATATATTCACAGGCTCTGG + Intergenic
1042413449 8:68491756-68491778 TGGAACATATTCACAGGTTTCGG + Intronic
1042524372 8:69749158-69749180 AGGAGCATATGCAATGGTTCTGG + Intronic
1042525590 8:69761548-69761570 GATAACATATTCATAGGTTCTGG + Intronic
1042773325 8:72402441-72402463 GCTAGCATAATCACAGTTTCTGG + Intergenic
1042835522 8:73076293-73076315 TATAACATATTCACAGATTCTGG - Intronic
1043083591 8:75798273-75798295 TGTAACATATTCATAGGTTTTGG + Intergenic
1043169996 8:76953925-76953947 AATAACATATTCACAGATCCTGG - Intergenic
1043191615 8:77229805-77229827 AGAAACATATTCACAGATTTTGG - Intergenic
1043713834 8:83455843-83455865 TGTTGCATATTCCCAGGCTCTGG + Intergenic
1043860107 8:85306496-85306518 GGTAATATAGTCACAGGTTCTGG - Intergenic
1044340951 8:91045554-91045576 GGTAAAATATTCACTGGTTCCGG - Intergenic
1044341829 8:91054825-91054847 GGTAGCATATTCACAGGTTCTGG + Intergenic
1044361538 8:91290707-91290729 CATAACATACTCACAGGTTCTGG + Intronic
1044368870 8:91384485-91384507 AGCAACATATTCGCAGTTTCTGG + Intronic
1044580715 8:93823367-93823389 AGTAACATATTTATAGGCTCTGG + Intergenic
1044590598 8:93910570-93910592 CATAGCATATTCACAGGTTCTGG - Intronic
1044943200 8:97364545-97364567 AGTGACATCTTCACAGGTTGTGG - Intergenic
1045078977 8:98603878-98603900 AGTAACATATTCACAAGTCCGGG - Intronic
1045259846 8:100562809-100562831 AGCAACATATTCATAGATTCTGG + Intergenic
1045323453 8:101099255-101099277 GCTAACATATTCGCAGGTTCTGG - Intergenic
1045323833 8:101102067-101102089 ACCAACATATTCACAAGTTCTGG + Intergenic
1045340110 8:101246117-101246139 GGTAACATATGAACAGGTTCTGG - Intergenic
1045499930 8:102737452-102737474 GGTAGCACATTCATAGATTCTGG + Intergenic
1045661369 8:104441396-104441418 AGTAACATATTCACAGGCTATGG - Intronic
1045872653 8:106943873-106943895 TGTAACAGATTCACAGCTTCAGG + Intergenic
1045919623 8:107514146-107514168 TGTAACATATTCGCAGGTTCTGG - Intergenic
1046025807 8:108722235-108722257 AGTAATATATTTACAGGTTTGGG + Intronic
1046069038 8:109228216-109228238 TATAACATATTCACAGGTTCTGG - Intergenic
1046183448 8:110682924-110682946 GGTAACATATTTATAGGTTCTGG - Intergenic
1046236957 8:111436703-111436725 AGTAACATATTCACAGGTTCCGG + Intergenic
1046583777 8:116125882-116125904 TGTAGCATATTCACAAGTTCTGG - Intergenic
1046631240 8:116625011-116625033 AGTAACATATTCACAGGTCTGGG + Intergenic
1046718866 8:117596665-117596687 AGTAGCATATACAGAGGTCCAGG + Intergenic
1046895845 8:119472157-119472179 GGTAACATATTCACAGTTTGTGG - Intergenic
1046980760 8:120334010-120334032 GGTAACATATTCACAGGTTCTGG + Intronic
1047179968 8:122578080-122578102 AGTAGCATATTTACAGCATCTGG - Intergenic
1047285493 8:123484160-123484182 ATTAGCATATTCACAAGAACAGG - Intergenic
1047294934 8:123562287-123562309 TTTAGTATATTCACAGGTTTGGG + Intergenic
1047436185 8:124837152-124837174 GGTCACATATTCACAGGGTCAGG + Intergenic
1047568791 8:126074756-126074778 TATACCATATTCACAGTTTCCGG + Intergenic
1047613361 8:126542492-126542514 GGTGACATATTCACAGGTTCTGG + Intergenic
1047711618 8:127558412-127558434 AGTAACATATTCATAGATTCTGG + Intergenic
1047902255 8:129436110-129436132 GGTCACATTTTCACAGGTTCTGG - Intergenic
1047919286 8:129617243-129617265 GAGAACATATTCACAGGTTCTGG - Intergenic
1048323503 8:133420948-133420970 AGTAACATATTCACAGGTTCTGG - Intergenic
1048450215 8:134526956-134526978 GGTAACATGTTCACATGTTCTGG - Intronic
1048454052 8:134561937-134561959 GGTAACATATTTACGGGTTCCGG - Intronic
1048664805 8:136649079-136649101 AGCTGCATATTCACAGGTCCTGG + Intergenic
1048902069 8:139048407-139048429 AGAAACATAATTACAGGTTCTGG - Intergenic
1049003608 8:139841321-139841343 GGTACCATATTTGCAGGTTCTGG + Intronic
1049940045 9:536753-536775 TGTAACATAGTCACAGGTTTGGG + Intronic
1050125557 9:2353216-2353238 GGTAACACATTCACACGTTCAGG + Intergenic
1050127876 9:2378263-2378285 GGTAACATATTCACAGCTTCAGG - Intergenic
1051475557 9:17504508-17504530 AGTAACACATTCGCAGGTTTCGG - Intergenic
1051550258 9:18319798-18319820 GGTAACATATTCACAGATTCAGG - Intergenic
1051599604 9:18859474-18859496 GGTAGCATATTCATAGGTTTCGG + Intronic
1051873733 9:21768739-21768761 CGTAACAGATTCACAGGTTTGGG - Intergenic
1051944553 9:22551582-22551604 CATAACATATACACAGGTTCTGG - Intergenic
1051947748 9:22592165-22592187 GGTAATATATTCATAGGTTCTGG - Intergenic
1052222978 9:26049969-26049991 AAGATCATATTCACAGATTCTGG + Intergenic
1052278114 9:26701801-26701823 CCTAACATTTTCACAGGTTCTGG - Intergenic
1052764542 9:32627378-32627400 AGCAACATATTCACAACTTCTGG + Intergenic
1052832569 9:33228273-33228295 GGTAACATATTCACAGGTTTGGG + Intronic
1052988594 9:34505495-34505517 AGTGACATATTTACAGGCTCAGG + Intronic
1053132114 9:35621557-35621579 AGTGACATAGTCACAGGTTCTGG - Intronic
1053294968 9:36906187-36906209 GGTCACATAGTCACAGGTTCTGG - Intronic
1053634863 9:39987511-39987533 ACTAACATATTCACAAATTCTGG + Intergenic
1053771063 9:41476823-41476845 ACTAACATATTCACAAATTCTGG - Intergenic
1054209024 9:62263186-62263208 ACTAACATATTCACAAATTCTGG - Intergenic
1054315787 9:63584953-63584975 ACTAACATATTCACAAATTCTGG + Intergenic
1054549797 9:66388628-66388650 ACTAACATATTCACAAATTCTGG - Intergenic
1054734500 9:68736848-68736870 AGTAGTATATTCACAAGTTCTGG + Intronic
1054862429 9:69967584-69967606 GGTAACATATTCATAGGTGCTGG + Intergenic
1054913536 9:70475811-70475833 AGCAGCATATGCAAAGGTACTGG - Intergenic
1054999746 9:71435735-71435757 AGTAGCATATTCACAGGTTCTGG - Intronic
1055401007 9:75924071-75924093 GGTAACATATTCATAGGTTCTGG + Intronic
1055665579 9:78549664-78549686 CCCAACATATTCACAGGTTCTGG - Intergenic
1055740206 9:79380064-79380086 AGTTACATATTCATAGGTTCTGG + Intergenic
1055811449 9:80153552-80153574 CTTAACATATTCACAGGTCCTGG - Intergenic
1055817153 9:80220151-80220173 GGTAAAATATTCACAGGTTTGGG + Intergenic
1055889835 9:81111687-81111709 GGTAACATATTCACAGGTTTGGG + Intergenic
1055957834 9:81791152-81791174 TGCAATATATTCACAGGTTCTGG - Intergenic
1056389888 9:86131331-86131353 AATAACATATTCACAGGTCCTGG + Intergenic
1056741331 9:89257865-89257887 GGTAACATATTTACAGCTTCTGG - Intergenic
1057166457 9:92930968-92930990 AGTAATATATTCAAAAGTTCTGG - Intergenic
1057250426 9:93496710-93496732 TGCAGCATATTCGCAGGTTCTGG + Intronic
1058335960 9:103829173-103829195 AGTAACATACTCACAGTTTCTGG + Intergenic
1058352611 9:104043834-104043856 AGTAACATATTCACAGGTTCTGG - Intergenic
1058562608 9:106245840-106245862 CCTAACATATTCACAGGTTCTGG + Intergenic
1058737736 9:107909323-107909345 TGTAACATATTCACAGATTTTGG + Intergenic
1059243770 9:112831909-112831931 GGTATCATATTCCCATGTTCAGG + Intronic
1059596077 9:115722130-115722152 GGTGACATATTCACAGGTACAGG + Intergenic
1060051434 9:120381251-120381273 AGTAACATATTCACAGGTTCCGG + Intergenic
1060118774 9:120968107-120968129 GGTAACATATTCACAGGTTCAGG - Intronic
1060204024 9:121671457-121671479 GGCAACATATTCACAGGTTCTGG + Intronic
1060541013 9:124430149-124430171 GGTAACATGTTCATAGGTTCTGG - Intergenic
1060764376 9:126282899-126282921 ACTGGCATATTCCCAGGTTCTGG - Intergenic
1060921399 9:127423021-127423043 CCTAACATATTCAGAGGTTCCGG - Intergenic
1061657277 9:132102142-132102164 GGTAACATATTCACAGGTTCTGG + Intergenic
1061694909 9:132365476-132365498 TGTAACATATTCACAGATTCTGG - Intergenic
1062045129 9:134421512-134421534 GGTCGCATAGTCCCAGGTTCTGG + Intronic
1062188944 9:135237025-135237047 GGTGACATAGTCACAGGTTCTGG + Intergenic
1062737668 9:138147156-138147178 AGTGGCATAATCACAGCTCCTGG - Intergenic
1185452116 X:288211-288233 AGGATCCCATTCACAGGTTCTGG + Intronic
1185653375 X:1665443-1665465 AGTCACATGTTCACAGGTGCAGG - Intergenic
1185737916 X:2507147-2507169 ATTACCATAGTGACAGGTTCCGG + Intergenic
1185922395 X:4108014-4108036 GGTCACATATTCACAGGTTCTGG - Intergenic
1186125018 X:6404068-6404090 AGTGACATATTCACAGTTTCAGG - Intergenic
1186125887 X:6413407-6413429 GGTCACATATTTACAGGTTCTGG - Intergenic
1186167687 X:6844305-6844327 TATAACATATTCACAGGTTTTGG + Intergenic
1186182202 X:6984343-6984365 CTTAGTATATTCACAGGTTTGGG - Intergenic
1186371577 X:8952545-8952567 AGCAACATATTCACAGGTTCTGG + Intergenic
1186420968 X:9426097-9426119 AGTAACATATTCACAGGTTCTGG - Intergenic
1186513842 X:10151164-10151186 AGCAACATCTTCACAGGTCCTGG + Intergenic
1186532631 X:10312582-10312604 GGTAACATAGTCACAGATTCGGG + Intergenic
1186552890 X:10525620-10525642 AGAAGCATATTCTGAGGTTAGGG + Intronic
1186672646 X:11782714-11782736 GGTAACATATTCACAGATCCTGG + Intergenic
1186698862 X:12067894-12067916 GGTAACATATTTACTGGTTCTGG - Intergenic
1186703220 X:12113708-12113730 GGAAGCATATTCTCAGGTTCTGG + Intergenic
1186748932 X:12601666-12601688 TGTTGAATATTCACAAGTTCTGG + Intronic
1186813638 X:13214604-13214626 AGTAACATATACACAGAATCTGG - Intergenic
1187034312 X:15521835-15521857 CGTAAGGTATTCACAGGTTCTGG + Intronic
1187093052 X:16117698-16117720 GGGAACATATTCACAGGTTCTGG - Intergenic
1187209426 X:17214548-17214570 AGTAACATATTCACAGGTTCTGG + Intergenic
1187301351 X:18053508-18053530 GGTATCCTATTCACAGGTTCTGG - Intergenic
1187360254 X:18619351-18619373 AGTAGGATATTTCCAGTTTCTGG + Intronic
1187504622 X:19868886-19868908 GGTGGCATATTCACAGGTTCGGG - Intronic
1187506228 X:19880663-19880685 GGGAACATAGTCACAGGTTCTGG - Intronic
1187531430 X:20100445-20100467 GATAGCATATTCACAGGTTCTGG - Intronic
1187780879 X:22822572-22822594 GGTGACATATTAACAGGTTCTGG + Intergenic
1187971035 X:24658773-24658795 GGTAACATATTCACAGGTTCTGG + Intronic
1188142127 X:26564496-26564518 TTTAACATACTCACAGGTTCTGG - Intergenic
1188266897 X:28087967-28087989 AGTAACATATTTACAGGTTCAGG + Intergenic
1188352855 X:29153332-29153354 GGTAATATATTCGCAGGTTCAGG + Intronic
1188359870 X:29240094-29240116 CCTAAAATATTCACAGGTTCTGG + Intronic
1188461685 X:30434484-30434506 CATAACATATTTACAGGTTCTGG - Intergenic
1188570545 X:31580175-31580197 CACAGCATATTCACAGGTTCTGG + Intronic
1189085818 X:38022714-38022736 GGTAACATATTCACAGGTTCTGG + Intronic
1189220763 X:39369700-39369722 TGTAACGTATTCACAGGTTCTGG - Intergenic
1189355449 X:40306882-40306904 ACGAACACATTCACAGGTTCTGG - Intergenic
1189483088 X:41408094-41408116 GGTAATATAGTCACAGGTTCTGG + Intergenic
1189595426 X:42559893-42559915 GGTAACATATTCATAGGTTCCGG + Intergenic
1190528609 X:51352732-51352754 TGTAACATATTCATAGTTTCTGG + Intergenic
1190891148 X:54569045-54569067 AGTAACATATTCAAAAGTTTTGG + Intergenic
1191154318 X:57255244-57255266 AGTAGTCTAATAACAGGTTCTGG + Intergenic
1191178437 X:57532715-57532737 AGTAGAAAATTCACTGGTACAGG - Intergenic
1191901457 X:66045110-66045132 CCTAACTTATTCACAGGTTCTGG - Intergenic
1191967617 X:66777222-66777244 GGTAACATGTTCACAGGTCCAGG - Intergenic
1192113760 X:68391595-68391617 AGTAACACATTCATAGGTTCTGG - Intronic
1193090896 X:77493028-77493050 GGTAACATATTCACAGGTGCTGG + Intergenic
1194079808 X:89446582-89446604 GGTGACATATTCACAGGTTTTGG - Intergenic
1194283974 X:91986843-91986865 GATAACATAGTCACAGGTTCTGG + Intronic
1195465269 X:105172771-105172793 AATATCCTGTTCACAGGTTCTGG + Intronic
1196123498 X:112075514-112075536 CATATCATATTCACAGGTTCTGG - Intronic
1196315734 X:114220969-114220991 AGTGTCATAATCACAGGTTCTGG + Intergenic
1196560063 X:117135533-117135555 AGTAACGTATTCAAAGGTTCTGG - Intergenic
1196636909 X:118012629-118012651 AGTGTCATAGTCACAGGTTCTGG + Intronic
1196790275 X:119458347-119458369 GGTAACATACTCACAGGTTCTGG - Intergenic
1197010808 X:121560860-121560882 TTTATCATATTCACAGGTTCTGG + Intergenic
1197056173 X:122121886-122121908 GATAACTTATTCACAGGTTCTGG + Intergenic
1197080666 X:122411720-122411742 AGTAGAAAATTCACTGGTACAGG - Intergenic
1197134753 X:123048212-123048234 AGTAATATAGTCACAGGTTCTGG - Intergenic
1197201362 X:123751642-123751664 CCTAACATATTCACAGGTTCTGG - Intergenic
1197557784 X:127977073-127977095 AGTAAAATATTCATAGGTTCTGG - Intergenic
1197974443 X:132151663-132151685 TATAACATATTCACAAGTTCTGG - Intergenic
1198258867 X:134948579-134948601 TGTAACATATTCACAGATGCTGG - Intergenic
1198279573 X:135128331-135128353 GGTAACATATTCACAGGTTATGG + Intergenic
1198291384 X:135244183-135244205 GGTAACATATTCACAGGTTATGG - Intergenic
1198857042 X:141030164-141030186 GGTAACATAGTCACAGGTTCTGG + Intergenic
1198905653 X:141557203-141557225 GGTAACATAGTCACAGGTTCTGG - Intergenic
1199675706 X:150187511-150187533 GGTAACATATTCACAGCTTCTGG + Intergenic
1199734804 X:150675798-150675820 TGTAACATATTCACGGGTTCTGG + Intergenic
1199735295 X:150680457-150680479 CCTCACATATTCACAGGTTCTGG - Intergenic
1199820998 X:151446391-151446413 CCTAACATATTCACAGGTTCCGG - Intergenic
1200432427 Y:3101871-3101893 GGTGACATATTCACAGGTTTTGG - Intergenic
1200492486 Y:3844588-3844610 GGTAGCATATTTACAGTCTCTGG - Intergenic
1200601542 Y:5211400-5211422 GATAACATAATCACAGGTTCTGG + Intronic
1201611575 Y:15848805-15848827 CATAGCATAATCAAAGGTTCAGG + Intergenic
1202091691 Y:21197634-21197656 AGTAGCATCTGGAGAGGTTCTGG + Intergenic