ID: 1134238475

View in Genome Browser
Species Human (GRCh38)
Location 16:12486343-12486365
Sequence GTAGCATATTCACAGGTTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134238465_1134238475 14 Left 1134238465 16:12486306-12486328 CCCTTAATTTCACCTCCTCTGCA 0: 1
1: 0
2: 2
3: 32
4: 401
Right 1134238475 16:12486343-12486365 GTAGCATATTCACAGGTTCTGGG No data
1134238466_1134238475 13 Left 1134238466 16:12486307-12486329 CCTTAATTTCACCTCCTCTGCAG No data
Right 1134238475 16:12486343-12486365 GTAGCATATTCACAGGTTCTGGG No data
1134238463_1134238475 27 Left 1134238463 16:12486293-12486315 CCCTGTGTCAGGGCCCTTAATTT No data
Right 1134238475 16:12486343-12486365 GTAGCATATTCACAGGTTCTGGG No data
1134238464_1134238475 26 Left 1134238464 16:12486294-12486316 CCTGTGTCAGGGCCCTTAATTTC No data
Right 1134238475 16:12486343-12486365 GTAGCATATTCACAGGTTCTGGG No data
1134238468_1134238475 2 Left 1134238468 16:12486318-12486340 CCTCCTCTGCAGTGGCCCCTGTA No data
Right 1134238475 16:12486343-12486365 GTAGCATATTCACAGGTTCTGGG No data
1134238469_1134238475 -1 Left 1134238469 16:12486321-12486343 CCTCTGCAGTGGCCCCTGTACAG No data
Right 1134238475 16:12486343-12486365 GTAGCATATTCACAGGTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134238475 Original CRISPR GTAGCATATTCACAGGTTCT GGG Intronic
No off target data available for this crispr