ID: 1134238480

View in Genome Browser
Species Human (GRCh38)
Location 16:12486371-12486393
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134238469_1134238480 27 Left 1134238469 16:12486321-12486343 CCTCTGCAGTGGCCCCTGTACAG No data
Right 1134238480 16:12486371-12486393 AGGCATAGACACTTTGGGAGAGG No data
1134238471_1134238480 14 Left 1134238471 16:12486334-12486356 CCCTGTACAGTAGCATATTCACA No data
Right 1134238480 16:12486371-12486393 AGGCATAGACACTTTGGGAGAGG No data
1134238470_1134238480 15 Left 1134238470 16:12486333-12486355 CCCCTGTACAGTAGCATATTCAC No data
Right 1134238480 16:12486371-12486393 AGGCATAGACACTTTGGGAGAGG No data
1134238468_1134238480 30 Left 1134238468 16:12486318-12486340 CCTCCTCTGCAGTGGCCCCTGTA No data
Right 1134238480 16:12486371-12486393 AGGCATAGACACTTTGGGAGAGG No data
1134238472_1134238480 13 Left 1134238472 16:12486335-12486357 CCTGTACAGTAGCATATTCACAG No data
Right 1134238480 16:12486371-12486393 AGGCATAGACACTTTGGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr