ID: 1134238656

View in Genome Browser
Species Human (GRCh38)
Location 16:12487555-12487577
Sequence CTTCTCCACGGAGGGCTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134238656_1134238664 8 Left 1134238656 16:12487555-12487577 CCACCCAGCCCTCCGTGGAGAAG No data
Right 1134238664 16:12487586-12487608 ACACGTCCATGCCCAAATCTAGG No data
1134238656_1134238666 14 Left 1134238656 16:12487555-12487577 CCACCCAGCCCTCCGTGGAGAAG No data
Right 1134238666 16:12487592-12487614 CCATGCCCAAATCTAGGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134238656 Original CRISPR CTTCTCCACGGAGGGCTGGG TGG (reversed) Intronic
No off target data available for this crispr