ID: 1134239479

View in Genome Browser
Species Human (GRCh38)
Location 16:12494870-12494892
Sequence GGTGCCACTGATGTGAAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134239479_1134239481 -7 Left 1134239479 16:12494870-12494892 CCCTGCTTCACATCAGTGGCACC No data
Right 1134239481 16:12494886-12494908 TGGCACCATCTTAATAAGAATGG No data
1134239479_1134239484 26 Left 1134239479 16:12494870-12494892 CCCTGCTTCACATCAGTGGCACC No data
Right 1134239484 16:12494919-12494941 TTGAGTGCTAACTGCATGCCAGG No data
1134239479_1134239485 30 Left 1134239479 16:12494870-12494892 CCCTGCTTCACATCAGTGGCACC No data
Right 1134239485 16:12494923-12494945 GTGCTAACTGCATGCCAGGCAGG 0: 1
1: 0
2: 2
3: 29
4: 214
1134239479_1134239482 -4 Left 1134239479 16:12494870-12494892 CCCTGCTTCACATCAGTGGCACC No data
Right 1134239482 16:12494889-12494911 CACCATCTTAATAAGAATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134239479 Original CRISPR GGTGCCACTGATGTGAAGCA GGG (reversed) Intronic
No off target data available for this crispr