ID: 1134239659

View in Genome Browser
Species Human (GRCh38)
Location 16:12496216-12496238
Sequence CTGTGTCACAACTTTGTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 269}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134239659_1134239666 24 Left 1134239659 16:12496216-12496238 CCTTGCACAAAGTTGTGACACAG 0: 1
1: 0
2: 0
3: 14
4: 269
Right 1134239666 16:12496263-12496285 GTCACATTCCACCCAAGTCAGGG No data
1134239659_1134239665 23 Left 1134239659 16:12496216-12496238 CCTTGCACAAAGTTGTGACACAG 0: 1
1: 0
2: 0
3: 14
4: 269
Right 1134239665 16:12496262-12496284 GGTCACATTCCACCCAAGTCAGG No data
1134239659_1134239667 25 Left 1134239659 16:12496216-12496238 CCTTGCACAAAGTTGTGACACAG 0: 1
1: 0
2: 0
3: 14
4: 269
Right 1134239667 16:12496264-12496286 TCACATTCCACCCAAGTCAGGGG No data
1134239659_1134239664 2 Left 1134239659 16:12496216-12496238 CCTTGCACAAAGTTGTGACACAG 0: 1
1: 0
2: 0
3: 14
4: 269
Right 1134239664 16:12496241-12496263 GTAGTCAGCTGGCAACTCACAGG No data
1134239659_1134239663 -9 Left 1134239659 16:12496216-12496238 CCTTGCACAAAGTTGTGACACAG 0: 1
1: 0
2: 0
3: 14
4: 269
Right 1134239663 16:12496230-12496252 GTGACACAGGGGTAGTCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134239659 Original CRISPR CTGTGTCACAACTTTGTGCA AGG (reversed) Intronic
901170232 1:7251604-7251626 CTGTGTGCCTACTCTGTGCAAGG + Intronic
901978298 1:13012723-13012745 CTGTGTCACAAATAAGTTCAAGG + Intronic
901979254 1:13021274-13021296 CTGTGTCACAAATAAGTTCAAGG + Intronic
901991044 1:13114218-13114240 CTGTGTCACAAATGAGTTCAAGG - Intergenic
902002828 1:13207664-13207686 CTGTGTCACAAATAAGTTCAAGG - Intergenic
902003786 1:13216215-13216237 CTGTGTCACAAATAAGTTCAAGG - Intergenic
902022056 1:13353428-13353450 CTGTGTCACAAATAAGTTCAAGG - Intergenic
902023011 1:13361959-13361981 CTGTGTCACAAATAAGTTCAAGG - Intergenic
903738802 1:25546175-25546197 CTGGGTCACAACCCTGAGCAAGG - Intronic
905978939 1:42205236-42205258 TTGAGTCACAACTTTGTGATGGG - Intronic
908022728 1:59915068-59915090 CTGTGTCACAAATAAGTTCAAGG - Intronic
908024692 1:59938432-59938454 CTGTGTCACAAATAAGTTCAAGG + Intergenic
909741652 1:79037033-79037055 CAGTGTCCCAAGGTTGTGCAGGG - Intergenic
911501180 1:98687079-98687101 CTGTGTGACTGCTTTGTGCCAGG + Intronic
911595419 1:99793833-99793855 CTGTGTCACAAATAAGTTCAAGG + Intergenic
912405135 1:109431319-109431341 CTGGGTCACCACCTTGTGCTAGG - Intergenic
914327054 1:146629195-146629217 CTGTGTCATAAATCAGTGCAGGG - Intergenic
914352142 1:146849695-146849717 CTGGGTTACCACTTGGTGCATGG - Intergenic
919110421 1:193212182-193212204 CTGTATCACATGTTTGTGCTTGG + Intronic
921206463 1:212853709-212853731 CTGTGGCAAACCTTTGTTCAGGG + Intergenic
921821144 1:219618851-219618873 CTGTGTCACAAATAAGTTCAAGG + Intergenic
924566148 1:245199906-245199928 ATGTGTCACAAATTTGTGTTAGG + Intronic
1063945517 10:11172341-11172363 CCTTGTCACATCTTTGTGAAAGG + Intronic
1065700956 10:28424880-28424902 TTGTTTCACATCATTGTGCAGGG + Intergenic
1070870284 10:79745291-79745313 CTGTGTCACAAATAAGTTCAAGG - Intergenic
1071637202 10:87267511-87267533 CTGTGTCACAAATAAGTTCAAGG - Intergenic
1071658043 10:87470443-87470465 CTGTGTCACAAATAAGTTCAAGG + Intergenic
1072265126 10:93720021-93720043 CTGTCTCACAGTTTTGTCCAGGG + Intergenic
1073599543 10:104833306-104833328 CTGAGTCTCAACATCGTGCATGG - Intronic
1074781224 10:116803704-116803726 ATGAGGCACATCTTTGTGCAAGG + Intergenic
1075890009 10:125940356-125940378 CTGTGTCACAAATAAGTTCAAGG + Intronic
1077400441 11:2353505-2353527 CTGTGTCACCACACTGTGGATGG + Intergenic
1077703224 11:4460744-4460766 CTGTGTCACAAATAAGTTCAAGG + Intergenic
1079592834 11:22201662-22201684 CTGTGTCATAACATGGTGGAAGG + Intronic
1082716327 11:56618596-56618618 CTGTGTCACAAATAAGTTCAAGG + Intergenic
1082969591 11:59005425-59005447 CTGTGTCACAAATAAGTTCAAGG - Intronic
1082982566 11:59136979-59137001 CTGTGTCACAAATAAGTTCAAGG - Intergenic
1085074425 11:73577505-73577527 CAGTGTCAGAACTTTGTAAAAGG - Intronic
1085536966 11:77227559-77227581 CTGAGTCCACACTTTGTGCAAGG - Intronic
1085606495 11:77904195-77904217 CTGTCACAGAAGTTTGTGCAAGG - Intronic
1087006029 11:93472719-93472741 CAGTGTAACAACTATGTGCCAGG - Intergenic
1088732708 11:112697445-112697467 CCATGTCTCAACTTTGTGCTAGG - Intergenic
1089204324 11:116746749-116746771 CTGTGACACTACTGTGTGCCAGG + Intergenic
1092908302 12:13122512-13122534 CTGTGTCACCACATGGTGGAAGG + Intronic
1095139056 12:38640177-38640199 CTGAGTCACAACTTAGTGGCTGG - Intergenic
1095373489 12:41498464-41498486 CTGTGTCATAACATGGTGGAAGG + Intronic
1095450967 12:42330053-42330075 CTGTGTCACAAATAAGTTCAAGG + Intronic
1095456179 12:42388415-42388437 CTGTGTCACAATTAAGTTCAAGG - Intronic
1096478455 12:51922862-51922884 CTGTCTCCCAGCATTGTGCAAGG + Intronic
1102064484 12:109962407-109962429 CTGAGTCACGTTTTTGTGCAAGG - Intronic
1104238051 12:126958950-126958972 CTGTGTCACAAATAAGTTCAAGG + Intergenic
1104547728 12:129727298-129727320 CTGTGTCATAACATGGTGGAAGG + Intronic
1104626365 12:130358971-130358993 GTGTGTCAGAAGTGTGTGCAGGG - Intronic
1105046198 12:133005761-133005783 CTATGTCATAACTTGGTGGAAGG - Intronic
1107523497 13:41206267-41206289 CTGTGTCACAACATGGTGGAAGG - Intergenic
1110710687 13:78647494-78647516 CTGTGTCACAAATAAGTTCAAGG - Intronic
1110913874 13:80997916-80997938 CTGTGTCATAACATTGTAGAAGG - Intergenic
1110938645 13:81321876-81321898 CTGTGTCACTGCATTTTGCATGG + Intergenic
1114604044 14:23981769-23981791 CTGTGTCACAAATAAGTTCAAGG + Intronic
1114609065 14:24024566-24024588 CTGTGTCACAAATAAGTTCAAGG + Intergenic
1115011969 14:28559479-28559501 CTGTGACACAACCCTGTTCATGG + Intergenic
1115441806 14:33444242-33444264 CAGTGTTACAACTTTGTTTAAGG + Intronic
1120450932 14:84665987-84666009 CTGTGTCACACCTTTCTCCAGGG + Intergenic
1121295702 14:92820258-92820280 CTGTGTCACAAATAAGTTCAAGG + Intronic
1121506660 14:94482912-94482934 CTGTGTCACAAATAAGTTCAAGG - Intergenic
1121673173 14:95729386-95729408 CTGTGTCACAAATAAGTTCAAGG + Intergenic
1123052901 14:105555517-105555539 CTGTGTCACAAGTAAGTTCAAGG - Intergenic
1123077483 14:105675908-105675930 CTGTGTCACAAATAAGTTCAAGG - Intergenic
1123178800 14:106447552-106447574 CTGTGTCACAAATAAGTTCAAGG + Intergenic
1124065439 15:26339139-26339161 CTCTGTCACATCTTTGTGAATGG - Intergenic
1126082306 15:44976260-44976282 CTGTCTCACAGCTTTTTGTAAGG + Intronic
1126954517 15:53917610-53917632 TTGTGTCACATTTTTGTCCAAGG - Intergenic
1127914997 15:63448009-63448031 CTGTTACACAACTTTGCCCAAGG + Intergenic
1129406627 15:75323572-75323594 CTGTGTCACAAATAAGTTCAAGG + Intergenic
1130555486 15:84919566-84919588 CTGTGTCATAACATGGTGGAAGG + Intronic
1131275040 15:90973777-90973799 CTGTGTCACAAATAAGTTCAAGG - Intronic
1133611292 16:7435829-7435851 TTATGACACAACTTAGTGCATGG - Intronic
1134239659 16:12496216-12496238 CTGTGTCACAACTTTGTGCAAGG - Intronic
1135634441 16:24062122-24062144 CTGTGTAACAAATTGCTGCAAGG + Intronic
1136060215 16:27721321-27721343 CCGTGTGGCAGCTTTGTGCAGGG + Intronic
1137740972 16:50773755-50773777 CTTTGTCACAACTGTGTTCATGG - Intronic
1138535917 16:57660323-57660345 CTGTGTCAGGACTTTGTGTTTGG + Intronic
1138699556 16:58847956-58847978 ATGTGTCGCAACTTTGTGGCAGG + Intergenic
1138926488 16:61597804-61597826 CTGTGTCTCCACTTAGAGCAAGG - Intergenic
1139427818 16:66894191-66894213 CGGGGTCACAAGCTTGTGCAGGG - Intronic
1139981888 16:70865837-70865859 CTGGGTTACCACTTGGTGCATGG + Intronic
1140006507 16:71081744-71081766 CTGTGTCATAAATCAGTGCAGGG + Intronic
1141416487 16:83879462-83879484 CTGTGTCACAAGTAAGTCCAAGG + Intergenic
1141803899 16:86329912-86329934 CTCACTCACAACTTTGTACACGG + Intergenic
1143463295 17:7117796-7117818 CTGGGTCAGAAATTTGGGCAGGG - Intergenic
1146530249 17:33602449-33602471 CTGTGTCATAACATGGTGGAAGG - Intronic
1146950536 17:36902317-36902339 CTGTGGCAAAACTGTGTGAAGGG + Intergenic
1148037457 17:44678195-44678217 CTGTGTCACTATTGGGTGCAAGG - Exonic
1148254491 17:46117348-46117370 CTATCTCACAAATTTGTGTATGG + Intronic
1148975454 17:51524045-51524067 CTGTGTCATAACATAGTGGAAGG + Intergenic
1150178048 17:63083097-63083119 CTGTGGCAGAAATTTGAGCAGGG - Intronic
1151249774 17:72825180-72825202 CAGTGTCCCAATGTTGTGCAGGG - Intronic
1151491331 17:74433541-74433563 CTGTCTCACCCCTCTGTGCAGGG - Intronic
1153878617 18:9400194-9400216 CTATGTCAGCACTTTGGGCAGGG - Exonic
1158326174 18:56315892-56315914 CTGTGTCACCTGTTTTTGCATGG + Intergenic
1158840757 18:61383981-61384003 CTGTGACACACTTGTGTGCATGG - Intronic
1162597289 19:11639451-11639473 GGGGGTCACAACTGTGTGCAGGG - Intergenic
1162648030 19:12064423-12064445 CAGTGTCATAAGTGTGTGCAGGG - Intergenic
1163534042 19:17866811-17866833 TTGAGTCCCTACTTTGTGCAGGG + Intergenic
1164010981 19:21203273-21203295 ATATGTCACAACATTGTGTATGG + Intergenic
1164041298 19:21494820-21494842 ATGTGTCACAATTTTCTGTATGG - Intergenic
1165969405 19:39613833-39613855 CAGTGTCCCAAGATTGTGCAGGG - Intergenic
1167735075 19:51289408-51289430 CTGTGTCCCCACTTGGTGGAAGG + Intergenic
925034663 2:676477-676499 CTGTGTCACTACTCTCTGCTGGG + Intronic
926006661 2:9378200-9378222 TTCTGTCTCCACTTTGTGCAGGG + Intronic
926064977 2:9831459-9831481 CTTTGTCAAAACTTTGTACACGG - Intergenic
927072569 2:19546024-19546046 CTGTGTCATAACATGGTGGAGGG - Intergenic
928040689 2:27873367-27873389 CTGAGTAACTACTTTGAGCAAGG + Intronic
928373389 2:30757163-30757185 CTGTGTCACGACATTTTTCACGG + Intronic
928476537 2:31632707-31632729 CTCAGTCACAACTTTGTGGCTGG - Intergenic
929041762 2:37751288-37751310 CTGTGTCACAAATAAGTTCAAGG - Intergenic
931108249 2:59081584-59081606 CAGTGTCACATTTTTATGCAAGG - Intergenic
932585876 2:73028444-73028466 CTGCCTCACAACTTGATGCATGG - Intronic
932892984 2:75612013-75612035 CAGGGTCCCAACTCTGTGCAGGG - Intergenic
932900795 2:75697524-75697546 CTGTGACAGAACTCTGTGCAGGG - Intronic
933126657 2:78617111-78617133 CAGTGTCAGAACTTTGTACTTGG - Intergenic
935132409 2:100270518-100270540 CTGTGTCACAAATAAGTTCAAGG - Intergenic
936600053 2:113887175-113887197 CTGTGTCAAAACATGGTGGAAGG + Intergenic
940261840 2:151789035-151789057 TTGAGTCACAACTATGTGCTTGG + Intronic
940522230 2:154765503-154765525 CTGAGTGCCAACTATGTGCAAGG - Intronic
941255939 2:163231029-163231051 TTGGGTCACCACTTTGTGCCAGG + Intergenic
941701268 2:168606414-168606436 TTGTGTCTCATCCTTGTGCAGGG + Intronic
943481668 2:188427499-188427521 CAGTGTCCCAAGTCTGTGCAGGG - Intronic
943730651 2:191300006-191300028 CTGTCTCACCACTTTCTGCATGG + Intronic
944555220 2:200881739-200881761 TTGTGTCTCATCCTTGTGCAGGG + Intronic
947710189 2:232309154-232309176 CTGAGCCACAACTTTGTACCAGG + Intronic
1170420728 20:16190237-16190259 CTGTGTCACCACATTGTAGAGGG - Intergenic
1171266703 20:23776915-23776937 TTGTGTCACATCTCTGTCCATGG - Intergenic
1171276247 20:23858551-23858573 TTGTGTCACATCTCTGTCCATGG - Intergenic
1172688208 20:36773317-36773339 CTGTGTCACAAGCTTGGGCCAGG - Intronic
1172977956 20:38920470-38920492 TTGTGCCACAACTTTGGTCATGG + Exonic
1174681452 20:52412666-52412688 CTGTGTCATAACATGGTGGAGGG - Intergenic
1174690889 20:52503522-52503544 CTGAGTCACATCTTTAAGCAAGG - Intergenic
1175057568 20:56212060-56212082 CTGTGTCACAAATAAGTTCAAGG + Intergenic
1177198854 21:17931011-17931033 CTGTATCACACCCTTGTGCCAGG - Intronic
1178410388 21:32358873-32358895 GTGTGTCAGAACCTTCTGCAGGG - Intronic
1179831975 21:44002563-44002585 CTGAGTCTCAATCTTGTGCATGG - Intergenic
1181727053 22:24818729-24818751 CTGTATCACACCGTTCTGCAGGG - Intronic
1182062851 22:27410342-27410364 CAGTGGCAGAACTTTGTGGAAGG - Intergenic
1185274480 22:49944415-49944437 CTGTGTCACAACCTCCTCCATGG - Intergenic
1203293984 22_KI270736v1_random:22808-22830 CTGTGTCACAAATAAGTTCAAGG - Intergenic
950972433 3:17202638-17202660 CAGTGTCCCAGGTTTGTGCAGGG - Intronic
951521363 3:23613684-23613706 TTGTGTGTCATCTTTGTGCAGGG + Intergenic
952638683 3:35563784-35563806 CTTTGTCATAACTTGGTGAAAGG - Intergenic
952718331 3:36505789-36505811 CTGTGGTACAAATTTGTACAAGG - Exonic
955061287 3:55493582-55493604 TTGTGTCACAACTATGAACAAGG - Intergenic
956378955 3:68645562-68645584 CTGTGTGACTACTCTGTGCCAGG + Intergenic
958761649 3:98316411-98316433 CTGTGTCACAAATAAGTTCAAGG + Intergenic
959149440 3:102591111-102591133 CAGTGTCCCGCCTTTGTGCAAGG - Intergenic
959791534 3:110367752-110367774 CTGTGTCACAAATAAGTTCAAGG - Intergenic
959973470 3:112432334-112432356 CTGTGGTACAGCTTTTTGCAAGG - Intergenic
961436171 3:126918750-126918772 CTATGTCACAAAGTTCTGCATGG - Intronic
962128676 3:132649494-132649516 CTGTGTCACAAATAAGTTCAAGG - Intronic
965950703 3:174304818-174304840 CTGTCTTACAGCTTTGTGGAAGG - Intergenic
966174784 3:177126041-177126063 CTGTGTGTCATCCTTGTGCAGGG + Intronic
966302666 3:178496653-178496675 CAGTGTCCCAAGGTTGTGCACGG - Intronic
966716075 3:183014002-183014024 CTGTGTCATAACATGGTGGAGGG + Intergenic
966771858 3:183511200-183511222 CTGTGTCACAAATAAGTTCAAGG + Intronic
967559458 3:190901373-190901395 CTGTGTCCCAAGGCTGTGCAGGG - Intergenic
968396315 4:241897-241919 CTGTGTCACAAATAAGTTCAAGG - Intergenic
969197268 4:5573026-5573048 CTGTTTCCCATCTTTCTGCAAGG + Intronic
970111708 4:12645038-12645060 CTGTGTCAAAACATGGTGGAAGG + Intergenic
970705400 4:18795508-18795530 CTGTGTCACAACATGGTAGAGGG + Intergenic
971015317 4:22483075-22483097 CTGTGTCACAGCTATGAGGAAGG - Intronic
974476018 4:62381443-62381465 CTGTGTCTCCATTGTGTGCAAGG + Intergenic
975506550 4:75144564-75144586 CAGTGTCCCAAGATTGTGCAGGG + Intergenic
975519651 4:75286874-75286896 CTGTGTCACAAATAAGTTCAAGG + Intergenic
975643463 4:76523949-76523971 CTGTGGCAGAACTTTAAGCAAGG + Intronic
975692928 4:76983536-76983558 ATAGGTCACAACTTTGGGCATGG - Intronic
976047077 4:80963273-80963295 CTGTGTCACTGCTTTGATCATGG + Intronic
977842397 4:101724452-101724474 GTAATTCACAACTTTGTGCAGGG - Intronic
980530455 4:134046263-134046285 CTGTGTCACAAATAAGTTCAAGG + Intergenic
980569416 4:134594446-134594468 CTTTGTCACTAATCTGTGCAAGG + Intergenic
981850552 4:149224668-149224690 CTTTCTCACAACATGGTGCAGGG - Intergenic
983001424 4:162419172-162419194 CTGTGTCACAAATAAGTTCAAGG - Intergenic
983313226 4:166093341-166093363 CTGTGTCACAATTAAGTTCAAGG + Intronic
983379160 4:166968963-166968985 ATGTCTCACAACCTGGTGCAAGG - Intronic
985734126 5:1567668-1567690 CTGTGTCACAAGTAAGTTCAAGG + Intergenic
985773557 5:1827877-1827899 CTGTGTCCTCACTTTGTGGAAGG - Intergenic
985909295 5:2866408-2866430 CTTTGTCAGCACTCTGTGCAAGG + Intergenic
986949964 5:13071081-13071103 CAGTGTCTCAAGGTTGTGCAGGG + Intergenic
987352756 5:17035920-17035942 CTGTGACACAAATTTTTCCATGG - Intergenic
988695552 5:33618794-33618816 CTGTGTCCCAATGTTGTGGATGG - Intronic
989085550 5:37672590-37672612 CTGTGTCACAAATAAGTTCAAGG - Intronic
992459364 5:76945650-76945672 CTGTGTCACAAATAAGTTCAAGG - Intergenic
992655997 5:78910065-78910087 CTGTGTCACAAATAAGTTCAAGG - Intronic
993516455 5:88841759-88841781 CTGAGTCACTACTATGTTCAAGG + Intronic
994127704 5:96187706-96187728 CTGAGTGCCCACTTTGTGCAAGG - Intergenic
994286324 5:97972565-97972587 CTTTGTCACAACTTTATTCATGG - Intergenic
994534115 5:101006468-101006490 CTGTGTCACAAATAAGTTCAAGG + Intergenic
995750512 5:115449083-115449105 CTGTGTCACAAATAAGTTCAAGG - Intergenic
996247226 5:121279965-121279987 TTGTTTCACAACTTGGAGCAAGG + Intergenic
997201994 5:132016096-132016118 CTGAGTCCCCACTATGTGCAAGG + Intergenic
997610381 5:135211806-135211828 CTGAACTACAACTTTGTGCAGGG + Intronic
999109429 5:149105462-149105484 CAGTGTAACAACTATTTGCATGG - Intergenic
999703397 5:154249210-154249232 CTGAATCACAACTTTGGGCATGG - Intronic
1000064935 5:157686233-157686255 CTGTGTCACAAATAAGTTCAAGG + Intergenic
1000284534 5:159815719-159815741 CTGTGTCATCACTTGGTGGAAGG - Intergenic
1000535059 5:162469488-162469510 CTGGGCCACAACTTTTTGAATGG - Intergenic
1002268861 5:178056296-178056318 CTGTGTCACAAATAAGTTCAAGG + Intergenic
1003833461 6:10040817-10040839 CTGTGTCCTCACTTGGTGCAAGG + Intronic
1004897882 6:20166547-20166569 ATGTGCAACAACTCTGTGCAGGG - Intronic
1005230593 6:23697481-23697503 CTGAGTCACAAATTTGCTCATGG - Intergenic
1005233793 6:23736247-23736269 CTTTGTCACAATTTTGTGTGAGG + Intergenic
1005430214 6:25748761-25748783 CTGTGTCACAAATAAGTTCAAGG + Intergenic
1005906480 6:30265403-30265425 CTGTGTCAGAATGTTGCGCATGG - Intergenic
1006682418 6:35806488-35806510 TGGTGTCACTACTTTGTGCTAGG - Intronic
1007571427 6:42893949-42893971 CTGTGTCACAAATAAGTTCAAGG + Intergenic
1007572448 6:42902909-42902931 CTGTGTCACAAATAAGTTCAAGG + Intergenic
1008034655 6:46733646-46733668 CTGTCTCACCACTTTCTGCAGGG + Intronic
1010587360 6:77669910-77669932 CTGCCACACAACTTTGTCCAGGG + Intergenic
1014526855 6:122511265-122511287 CTGTGGAACAATTTTGTGCTTGG - Intronic
1014623175 6:123694676-123694698 CTGAGTCATAAATTTGTCCATGG - Intergenic
1015402272 6:132799866-132799888 CTGAGTTACCACTTTGTGCCAGG + Intergenic
1016640262 6:146340404-146340426 CTGTGTAAGAAATTAGTGCAAGG + Intronic
1016762961 6:147760015-147760037 CTGTGTCTAATCTTTCTGCATGG + Intergenic
1017903756 6:158740959-158740981 CATTGTGAGAACTTTGTGCAGGG - Intronic
1018193114 6:161328461-161328483 CTGTGTCAAAACTTGGCACAGGG - Intergenic
1020783959 7:12550893-12550915 CTGTGTCTTTACTTTGTGCTAGG + Intergenic
1021824646 7:24537392-24537414 CTGTGTGTCATCCTTGTGCAGGG - Intergenic
1028439657 7:90845163-90845185 CTGAGTGACTACTCTGTGCAAGG - Intronic
1029790606 7:102839210-102839232 CTGTGTCACAATTAAGTTCAAGG - Intronic
1029882179 7:103826159-103826181 CTGTGTCATAACATGGTGGAAGG - Intronic
1031035920 7:116787490-116787512 CTGTGTCATAACATGGTGGAAGG + Intronic
1031287442 7:119887641-119887663 CTTTGTCATAACTTTTTGCCAGG + Intergenic
1031379990 7:121073887-121073909 CTGTGTCCCAATGTTGTGCATGG - Intronic
1032001225 7:128266733-128266755 CTGTCTCACAGCCTTGTGAAAGG + Intergenic
1033231906 7:139604857-139604879 CTGTCCCACAACTATGTACAGGG + Intronic
1035180296 7:157084597-157084619 CAGTGTCCCAAGGTTGTGCAAGG - Intergenic
1037586201 8:20277987-20278009 CTGTAACACAACTATGTGCCAGG - Intronic
1038541975 8:28397402-28397424 CTATGTCACAACATGGTGGAAGG - Intronic
1038730041 8:30118800-30118822 CTGTGTCACAAATAAGTTCAAGG + Intronic
1039772568 8:40702089-40702111 CTGTGTCATAACATGGTGGAGGG - Intronic
1039853756 8:41395224-41395246 CTGTGTCATAACATGGTGAAGGG + Intergenic
1040112990 8:43580461-43580483 CTGTGAAACAACTTTGTGATAGG + Intergenic
1041136742 8:54767105-54767127 CTGTAACACAACTGTGTACAAGG + Intergenic
1041913961 8:63120760-63120782 CTATGGCACAACTTTGCTCAGGG - Intergenic
1042409031 8:68441147-68441169 ATGTGTCAGAAGTCTGTGCACGG + Intronic
1046010008 8:108534714-108534736 CTGTGTCTCATCTCTGTGGAAGG + Intergenic
1049634717 8:143681443-143681465 CTGTGTCATAGCTTCATGCAGGG - Intergenic
1049649594 8:143759297-143759319 CAGTGCCAGAACTCTGTGCAAGG - Intergenic
1050385188 9:5082309-5082331 CTGTGTCACAAATAAGTTCAAGG + Intronic
1051869069 9:21715545-21715567 CAGTGTCCCAACACTGTGCAGGG + Intergenic
1052079953 9:24192530-24192552 CTGTGTCATAACATAGTGGAAGG + Intergenic
1055425652 9:76193486-76193508 CTCTCTCTCAAGTTTGTGCAGGG + Intronic
1058022196 9:100101220-100101242 CTGAGTGACAACTATGTGCTAGG - Intronic
1058461570 9:105188796-105188818 CTGGGCCATAGCTTTGTGCAGGG + Intergenic
1059982276 9:119785992-119786014 CTGTGTCCTAACTGCGTGCATGG - Intergenic
1060808536 9:126594923-126594945 CTGTGTCCTAACATGGTGCAAGG - Intergenic
1060877107 9:127091474-127091496 CTGTGACCCAGCTTTGTGAAGGG + Intronic
1061560268 9:131397586-131397608 ATGAGTCAGTACTTTGTGCAAGG - Intronic
1185593290 X:1292558-1292580 CTGTGTCACAAATAAGTTCAAGG + Intronic
1186006490 X:5078007-5078029 CTGTCTCATAACATTGTGGAAGG + Intergenic
1186716588 X:12258422-12258444 CTGTGTCATAACATGGTGGAAGG - Intronic
1187050404 X:15690258-15690280 CTGAGTGGCAACTATGTGCAAGG + Intronic
1187255638 X:17639475-17639497 CTGTGTCATAACATTGTGGAAGG + Intronic
1187390708 X:18884917-18884939 CTGTGTCACAATTTTGCCAAAGG + Intergenic
1187403169 X:18980553-18980575 CTGTGTCACAAATAAGTTCAAGG - Intronic
1188397106 X:29698469-29698491 CTCTGGAATAACTTTGTGCATGG + Intronic
1188902692 X:35753361-35753383 CTGTGTTATAATTTTGTGAAGGG + Intergenic
1189244853 X:39555467-39555489 CTGTGTGACAACTTATTTCAAGG - Intergenic
1189351043 X:40275985-40276007 CTGGGTCAGGAATTTGTGCAGGG + Intergenic
1191018451 X:55835489-55835511 CTGTGTCACAAATAAGTTCAAGG + Intergenic
1191094532 X:56660648-56660670 CAGGGTCAAAACTTTGTGCCAGG + Intergenic
1193216654 X:78872464-78872486 CTGTTTTACACCTCTGTGCAAGG + Intergenic
1193439336 X:81519273-81519295 CTGTGTCACTATTTTAGGCAAGG - Intergenic
1193597889 X:83469960-83469982 GTGTCTCACAACTTTGTACTCGG - Intergenic
1193684741 X:84563571-84563593 CTGAGTAACTACTATGTGCAAGG - Intergenic
1193865807 X:86728645-86728667 CTGTGTCCCAAGGCTGTGCAGGG - Intronic
1195239471 X:102937089-102937111 CTGTGTCACTACTCTGTGCTGGG + Intergenic
1195298230 X:103500965-103500987 CTGTGTCACTACTCTGTGCTGGG - Exonic
1195678123 X:107522950-107522972 CTGCTTCACAATTTTGTTCAGGG + Intronic
1195814243 X:108867881-108867903 CAGTGTCCCAAGTCTGTGCAGGG + Intergenic
1197134043 X:123040307-123040329 TTGTGACCCATCTTTGTGCATGG - Intergenic
1198596145 X:138237979-138238001 TTATGTCACAACTTTGAGCCAGG + Intergenic
1200257179 X:154589350-154589372 CTGTGTCACAAATAAGTTCAAGG - Intergenic
1200259902 X:154608691-154608713 CTGTGTCACAAATAAGTTCAAGG + Intergenic
1200260591 X:154615052-154615074 CTGTGTCACAAATAAGTTCAAGG + Intergenic
1201382686 Y:13401186-13401208 CTGTGTCAGAACATGGTGGAAGG - Intronic