ID: 1134241602

View in Genome Browser
Species Human (GRCh38)
Location 16:12510867-12510889
Sequence CCACGGTGCTTGGCACAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134241602_1134241613 5 Left 1134241602 16:12510867-12510889 CCAGCCTGTGCCAAGCACCGTGG No data
Right 1134241613 16:12510895-12510917 AGAAGGAGTCATCGCAGGTGGGG No data
1134241602_1134241616 19 Left 1134241602 16:12510867-12510889 CCAGCCTGTGCCAAGCACCGTGG No data
Right 1134241616 16:12510909-12510931 CAGGTGGGGTCCTTCCTGTGGGG No data
1134241602_1134241615 18 Left 1134241602 16:12510867-12510889 CCAGCCTGTGCCAAGCACCGTGG No data
Right 1134241615 16:12510908-12510930 GCAGGTGGGGTCCTTCCTGTGGG No data
1134241602_1134241610 0 Left 1134241602 16:12510867-12510889 CCAGCCTGTGCCAAGCACCGTGG No data
Right 1134241610 16:12510890-12510912 AGGGTAGAAGGAGTCATCGCAGG No data
1134241602_1134241617 26 Left 1134241602 16:12510867-12510889 CCAGCCTGTGCCAAGCACCGTGG No data
Right 1134241617 16:12510916-12510938 GGTCCTTCCTGTGGGGAGACAGG No data
1134241602_1134241612 4 Left 1134241602 16:12510867-12510889 CCAGCCTGTGCCAAGCACCGTGG No data
Right 1134241612 16:12510894-12510916 TAGAAGGAGTCATCGCAGGTGGG 0: 1
1: 0
2: 0
3: 10
4: 85
1134241602_1134241611 3 Left 1134241602 16:12510867-12510889 CCAGCCTGTGCCAAGCACCGTGG No data
Right 1134241611 16:12510893-12510915 GTAGAAGGAGTCATCGCAGGTGG No data
1134241602_1134241614 17 Left 1134241602 16:12510867-12510889 CCAGCCTGTGCCAAGCACCGTGG No data
Right 1134241614 16:12510907-12510929 CGCAGGTGGGGTCCTTCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134241602 Original CRISPR CCACGGTGCTTGGCACAGGC TGG (reversed) Intronic
No off target data available for this crispr