ID: 1134243789

View in Genome Browser
Species Human (GRCh38)
Location 16:12524832-12524854
Sequence GAGCAGTACTTACACGAAGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 60}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134243789_1134243792 -10 Left 1134243789 16:12524832-12524854 CCTTCTTCGTGTAAGTACTGCTC 0: 1
1: 0
2: 1
3: 3
4: 60
Right 1134243792 16:12524845-12524867 AGTACTGCTCCCACGGACATGGG 0: 1
1: 0
2: 1
3: 3
4: 73
1134243789_1134243801 29 Left 1134243789 16:12524832-12524854 CCTTCTTCGTGTAAGTACTGCTC 0: 1
1: 0
2: 1
3: 3
4: 60
Right 1134243801 16:12524884-12524906 CATTTTTTTCTCGGTCGTTTTGG 0: 1
1: 0
2: 0
3: 12
4: 186
1134243789_1134243798 20 Left 1134243789 16:12524832-12524854 CCTTCTTCGTGTAAGTACTGCTC 0: 1
1: 0
2: 1
3: 3
4: 60
Right 1134243798 16:12524875-12524897 CCCTGCCAGCATTTTTTTCTCGG 0: 1
1: 0
2: 5
3: 40
4: 447

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134243789 Original CRISPR GAGCAGTACTTACACGAAGA AGG (reversed) Exonic