ID: 1134243789

View in Genome Browser
Species Human (GRCh38)
Location 16:12524832-12524854
Sequence GAGCAGTACTTACACGAAGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 60}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134243789_1134243792 -10 Left 1134243789 16:12524832-12524854 CCTTCTTCGTGTAAGTACTGCTC 0: 1
1: 0
2: 1
3: 3
4: 60
Right 1134243792 16:12524845-12524867 AGTACTGCTCCCACGGACATGGG 0: 1
1: 0
2: 1
3: 3
4: 73
1134243789_1134243798 20 Left 1134243789 16:12524832-12524854 CCTTCTTCGTGTAAGTACTGCTC 0: 1
1: 0
2: 1
3: 3
4: 60
Right 1134243798 16:12524875-12524897 CCCTGCCAGCATTTTTTTCTCGG 0: 1
1: 0
2: 5
3: 40
4: 447
1134243789_1134243801 29 Left 1134243789 16:12524832-12524854 CCTTCTTCGTGTAAGTACTGCTC 0: 1
1: 0
2: 1
3: 3
4: 60
Right 1134243801 16:12524884-12524906 CATTTTTTTCTCGGTCGTTTTGG 0: 1
1: 0
2: 0
3: 12
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134243789 Original CRISPR GAGCAGTACTTACACGAAGA AGG (reversed) Exonic
900800821 1:4735940-4735962 GAGCAGAGCTTAGAGGAAGAGGG + Intronic
912746959 1:112253013-112253035 GAGCAGAACTTACTGGAAGGTGG + Intergenic
914224252 1:145707304-145707326 GAGCAGTTCTTACCTGGAGATGG + Exonic
917130100 1:171732669-171732691 CAGCAGTACTTAAAGGAAAATGG + Intronic
919088937 1:192955162-192955184 TAGCATTACTTAAAGGAAGATGG - Intergenic
919254344 1:195102126-195102148 GAGTAGTATTTACACCATGATGG + Intergenic
921887661 1:220322665-220322687 GAGCAGTCCTTCCAGGAAGAGGG - Intergenic
1064491400 10:15860719-15860741 GAGCAGTGCGTAGAGGAAGAAGG - Intergenic
1067918981 10:50433748-50433770 GAGCAGTATTTCCACTATGAAGG + Intronic
1075491424 10:122873764-122873786 GAGCAGTGCTTACAGGGAAACGG - Intronic
1076165308 10:128277578-128277600 GAGCAGGACTCACACGGAAATGG + Intergenic
1085346327 11:75770339-75770361 GAGCAGCACCCACACCAAGAGGG - Intronic
1091037561 11:132247188-132247210 GAGCTGGACATACACGCAGATGG - Intronic
1098963400 12:76762532-76762554 GAGCAGCAGTTACTCAAAGAGGG - Intergenic
1110973987 13:81806263-81806285 GAGCAGTATTGCCACAAAGAGGG + Intergenic
1113090317 13:106611223-106611245 AAGCAGTACATACATGAAAAAGG + Intergenic
1125187871 15:36952877-36952899 GAGCTGTACTTTCACTATGAAGG + Intronic
1131285492 15:91053566-91053588 GAGCAGTACTAAGACTAGGAGGG - Intergenic
1134243789 16:12524832-12524854 GAGCAGTACTTACACGAAGAAGG - Exonic
1139823719 16:69740672-69740694 GAGCAGGAGTTTCACAAAGATGG + Intergenic
1154173768 18:12068403-12068425 GAGCAGCACGTACGCCAAGAGGG - Intergenic
1157437149 18:47680455-47680477 GAGCAGAATTTTCAGGAAGAGGG - Intergenic
925515836 2:4680557-4680579 GAGCAGTCATAACACGGAGAGGG - Intergenic
925898549 2:8492153-8492175 GAGCAGTTCCAACACGAAGTTGG - Intergenic
929531433 2:42755506-42755528 GAGCTTTACTTACAAGAGGAAGG - Exonic
929685749 2:44032735-44032757 GATCAGTATTTACAGAAAGAAGG + Intergenic
933256387 2:80085773-80085795 GAGCACAACTGACACAAAGAGGG - Intronic
934506180 2:94896583-94896605 AAGCAGTACGTAGACCAAGAGGG + Intergenic
935396275 2:102612645-102612667 CATCAGTATTTACACTAAGATGG - Intergenic
938985991 2:136576929-136576951 GAGCAGTAGTAAAAAGAAGAGGG - Intergenic
941024828 2:160446978-160447000 AAGCATTAGTTACATGAAGAAGG - Intronic
944517006 2:200522280-200522302 GAGCAGCTCTTAAAAGAAGAGGG - Intronic
947279342 2:228431759-228431781 GAGCAGAACTTTCATCAAGAAGG - Intergenic
1170232461 20:14065237-14065259 GAGGAGTCCTAACACCAAGAGGG - Intronic
1177521505 21:22233800-22233822 GAACAGAATTTACACAAAGATGG - Intergenic
949102047 3:157346-157368 GAGCTGTAGCTACACAAAGATGG + Intergenic
950264773 3:11565462-11565484 GAGCAGTACTGTGAGGAAGATGG - Intronic
951116910 3:18874409-18874431 TAGCAGGAACTACACGAAGAAGG + Intergenic
959568000 3:107852458-107852480 GATTAGTACTCTCACGAAGAAGG + Intergenic
959932752 3:112000997-112001019 GAGCAGTTTTTACAAGGAGATGG - Intronic
960742627 3:120851638-120851660 GATCAGTCCTTGCACGAAGAGGG + Intergenic
964784297 3:160377458-160377480 GAGCAGTACTTGCAGGAAGATGG - Exonic
970847073 4:20553287-20553309 GAGAAGTATTTACAAGATGATGG - Intronic
984035744 4:174665281-174665303 GAACAGTAGTTACCCAAAGAAGG - Intronic
984291513 4:177801005-177801027 GAGCAGTAGTTACCAGAGGATGG - Intronic
985478018 5:90841-90863 GGGCAGTACTGTCACGAGGACGG + Intergenic
995166776 5:109052752-109052774 GAGTAGTACTTACACTCATAGGG + Intronic
1003113679 6:3269123-3269145 CAGCAGAACATACACGAACAAGG + Intronic
1008329976 6:50233125-50233147 GAGCTGAACTCACACTAAGAAGG + Intergenic
1008360232 6:50608792-50608814 AAGCTGTATTTACACGAAGTGGG - Intergenic
1010057110 6:71579321-71579343 GAGCAGTTCTTACCAGAAGCTGG - Intergenic
1015907526 6:138132354-138132376 AAGCAGTACTAAGACTAAGACGG - Intergenic
1018240576 6:161770265-161770287 GAGCAGAACTTACATACAGAGGG + Intronic
1018949378 6:168369235-168369257 GAGCAGTACATACAGAAGGAGGG - Intergenic
1022393737 7:29966331-29966353 GGGCACTCCTTCCACGAAGAGGG - Intronic
1024550773 7:50561001-50561023 GAGCAGTACTCACAGGCAGCCGG + Intronic
1027757814 7:82237513-82237535 AAGAAGTACTTAAACGAATAAGG - Intronic
1029366437 7:100119494-100119516 TTGCAGTAATTACACCAAGAGGG - Intronic
1029488795 7:100859110-100859132 AAGCAGGACATAGACGAAGAAGG - Exonic
1041698460 8:60762185-60762207 GAGCAGTAGTTAGAGGAAGATGG - Intronic
1042811502 8:72830483-72830505 AAGCAGTTCTTACATGAATAAGG - Intronic
1057060350 9:91998593-91998615 GGGCAGGACTAACACCAAGAAGG + Intergenic
1189892018 X:45612758-45612780 GACCAGTACTTACAAGCACATGG + Intergenic
1193132600 X:77933032-77933054 GAGCAGTACTTGCACAGAGTAGG - Intronic
1200354174 X:155530818-155530840 CAGCAGTAGTTCCACGAAGGTGG + Intronic