ID: 1134243792

View in Genome Browser
Species Human (GRCh38)
Location 16:12524845-12524867
Sequence AGTACTGCTCCCACGGACAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 73}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134243788_1134243792 -9 Left 1134243788 16:12524831-12524853 CCCTTCTTCGTGTAAGTACTGCT 0: 1
1: 0
2: 0
3: 4
4: 93
Right 1134243792 16:12524845-12524867 AGTACTGCTCCCACGGACATGGG 0: 1
1: 0
2: 1
3: 3
4: 73
1134243782_1134243792 22 Left 1134243782 16:12524800-12524822 CCCCAAGAAGGAGACCCTCATCC 0: 1
1: 0
2: 1
3: 16
4: 190
Right 1134243792 16:12524845-12524867 AGTACTGCTCCCACGGACATGGG 0: 1
1: 0
2: 1
3: 3
4: 73
1134243785_1134243792 8 Left 1134243785 16:12524814-12524836 CCCTCATCCAGCTGATGCCCTTC 0: 1
1: 0
2: 3
3: 21
4: 218
Right 1134243792 16:12524845-12524867 AGTACTGCTCCCACGGACATGGG 0: 1
1: 0
2: 1
3: 3
4: 73
1134243784_1134243792 20 Left 1134243784 16:12524802-12524824 CCAAGAAGGAGACCCTCATCCAG 0: 1
1: 0
2: 1
3: 21
4: 236
Right 1134243792 16:12524845-12524867 AGTACTGCTCCCACGGACATGGG 0: 1
1: 0
2: 1
3: 3
4: 73
1134243786_1134243792 7 Left 1134243786 16:12524815-12524837 CCTCATCCAGCTGATGCCCTTCT 0: 1
1: 1
2: 1
3: 40
4: 317
Right 1134243792 16:12524845-12524867 AGTACTGCTCCCACGGACATGGG 0: 1
1: 0
2: 1
3: 3
4: 73
1134243783_1134243792 21 Left 1134243783 16:12524801-12524823 CCCAAGAAGGAGACCCTCATCCA 0: 1
1: 0
2: 2
3: 8
4: 163
Right 1134243792 16:12524845-12524867 AGTACTGCTCCCACGGACATGGG 0: 1
1: 0
2: 1
3: 3
4: 73
1134243781_1134243792 26 Left 1134243781 16:12524796-12524818 CCAGCCCCAAGAAGGAGACCCTC 0: 1
1: 0
2: 1
3: 28
4: 219
Right 1134243792 16:12524845-12524867 AGTACTGCTCCCACGGACATGGG 0: 1
1: 0
2: 1
3: 3
4: 73
1134243789_1134243792 -10 Left 1134243789 16:12524832-12524854 CCTTCTTCGTGTAAGTACTGCTC 0: 1
1: 0
2: 1
3: 3
4: 60
Right 1134243792 16:12524845-12524867 AGTACTGCTCCCACGGACATGGG 0: 1
1: 0
2: 1
3: 3
4: 73
1134243787_1134243792 1 Left 1134243787 16:12524821-12524843 CCAGCTGATGCCCTTCTTCGTGT 0: 1
1: 0
2: 1
3: 9
4: 98
Right 1134243792 16:12524845-12524867 AGTACTGCTCCCACGGACATGGG 0: 1
1: 0
2: 1
3: 3
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134243792 Original CRISPR AGTACTGCTCCCACGGACAT GGG Intronic
905108001 1:35575341-35575363 AGTGCTGTTCCCACGGAGTTGGG + Intronic
909482850 1:76144000-76144022 TGTACTGCTCACAGTGACATGGG - Intronic
911422917 1:97667763-97667785 AATAATGCTCCCACAAACATAGG - Intronic
916446070 1:164872962-164872984 AGTATTTCTCCAACAGACATTGG + Intronic
918242208 1:182630506-182630528 CGTTCTGCTCCCATGGATATGGG + Intergenic
920270064 1:204756003-204756025 ATTAATGCTTCCACGGCCATAGG + Intergenic
920498622 1:206472624-206472646 AGTACTGCTCCAAGAGAGATGGG - Intronic
923883568 1:238130399-238130421 AGTCCTGCTCCCAGGCACTTAGG - Intergenic
1062916198 10:1242636-1242658 AGCACTGCTCCCACTCACAGGGG - Intronic
1064851589 10:19714569-19714591 AGGACTGTGCCCACGGACGTAGG - Intronic
1069203436 10:65652913-65652935 AGTTGTGCTCCCACTGACAGTGG - Intergenic
1070604573 10:77889724-77889746 AGCACTGCACCCTCTGACATTGG + Intronic
1076436489 10:130448490-130448512 AGTAATGCTCCAATGAACATGGG + Intergenic
1077119068 11:898532-898554 AGTACTGCTCCCCAGGATGTTGG - Intronic
1077750373 11:4961261-4961283 TCTACTGCTCCCTTGGACATCGG - Intronic
1081642922 11:44769735-44769757 ACTACAGTTCCCATGGACATGGG - Intronic
1091651945 12:2317209-2317231 AGTGATGCTACCACGAACATGGG - Intronic
1093517436 12:20005253-20005275 AGTACTACACCCAGTGACATAGG - Intergenic
1094544219 12:31389366-31389388 AATACTGCACCCAGGAACATTGG - Exonic
1096523964 12:52199767-52199789 AGCACTGCTCCAACTGACATAGG + Intergenic
1096913583 12:55009126-55009148 AGTACTGTTCTCACTGACTTCGG + Intergenic
1098174454 12:67776424-67776446 AGTAATGCTACAATGGACATGGG - Intergenic
1102757257 12:115352367-115352389 ACTAATGCTGCCACGAACATGGG + Intergenic
1103560163 12:121789436-121789458 AGTCCTGCTTCCAGGGACAGGGG + Intronic
1107225729 13:38045404-38045426 AGTAGGGCTCCCAGGGACAACGG + Intergenic
1113944836 13:114038327-114038349 CGTGCTGCTCCCACGGACCTTGG - Intronic
1117114857 14:52500154-52500176 AGTAATGCTGCAATGGACATGGG - Intronic
1126538141 15:49790972-49790994 AGTACTGCTCACACAGGTATAGG - Intergenic
1133695721 16:8260588-8260610 AGTACTTCTCTCAAGGACTTTGG + Intergenic
1134243792 16:12524845-12524867 AGTACTGCTCCCACGGACATGGG + Intronic
1143248731 17:5506471-5506493 AGTAATGCTGCCATGAACATAGG - Intronic
1144210269 17:13008555-13008577 AGTTCAGCTCCCAGGGAGATGGG - Intronic
1150815553 17:68389567-68389589 AGTACTGCTCCCACGGCCTAGGG + Intronic
1153727721 18:7974612-7974634 AGTAATCTTCCCAGGGACATGGG + Intronic
1162015711 19:7845460-7845482 AGTGATGGCCCCACGGACATCGG - Intronic
928548039 2:32346345-32346367 AATAATGCTCCCATGAACATTGG + Intergenic
929466660 2:42150954-42150976 AGTAATGCTGCCAAGAACATTGG - Intergenic
933841902 2:86293849-86293871 AGTAATGCTGCCATGAACATGGG - Intronic
934707477 2:96493992-96494014 AGTATTGCTCCCAAGGACATAGG + Intergenic
935615150 2:105070638-105070660 AGTGCTGCTCCCTAGGACGTAGG + Intronic
937491724 2:122376228-122376250 ACTACTGCTCCTACGGACTGTGG + Intergenic
937821127 2:126312307-126312329 TCTACTGTTCCCAGGGACATGGG - Intergenic
1170931537 20:20773340-20773362 AGGGCTGCTCCCAAGGACAGAGG - Intergenic
1172747569 20:37224508-37224530 AGTACTGCCTCCATGGACTTGGG - Intronic
1177802206 21:25839173-25839195 CGTACTGCTGCCAAGGAGATGGG + Intergenic
1179653150 21:42827873-42827895 AATAGTGCTGCAACGGACATGGG + Intergenic
1181050745 22:20237238-20237260 AGTCCTGCTCCCAGGGGCAGGGG - Intergenic
1181557697 22:23681371-23681393 AGTACTTCACCCAGGGACCTGGG - Intergenic
1181971836 22:26696615-26696637 AATAATGCTGCCACGAACATTGG + Intergenic
1182007922 22:26976804-26976826 TCCACTGCTCCCACCGACATTGG - Intergenic
1183983379 22:41555612-41555634 AGAGCTACTCCCACGGACCTGGG + Intergenic
1184845208 22:47078825-47078847 AGGAATGCTCCCACGGAGACTGG + Intronic
955464293 3:59220155-59220177 AATACTGCTGCCAGGAACATGGG + Intergenic
967571070 3:191028854-191028876 AGAACTGCTGCCACTGACTTGGG - Intergenic
972754793 4:42034718-42034740 AGTACTGCTGCTATGAACATGGG + Intronic
973833528 4:54786305-54786327 AATACTGCTGCAATGGACATGGG + Intergenic
976452722 4:85210245-85210267 AATACTGCTCCAACAAACATGGG + Intergenic
978766061 4:112406176-112406198 AATAGTGCTGCCATGGACATAGG - Intronic
985417275 4:189749294-189749316 AGTAATGCTGCTATGGACATGGG + Intergenic
985630402 5:1010941-1010963 AGTGCAGCTCCCAGGGCCATGGG + Intronic
998452389 5:142244979-142245001 AGCACTGCTGGCATGGACATTGG + Intergenic
998547019 5:143037939-143037961 TGTCCTGCTCCCACAGACCTGGG - Intronic
1002477057 5:179473010-179473032 AGGCCTGCGCCCACGGACCTAGG - Intergenic
1003405274 6:5822784-5822806 AGTAATGCTGCCAGGCACATAGG - Intergenic
1007074903 6:39060191-39060213 AGAACTGCTCCCACACACCTGGG - Intronic
1013931554 6:115540648-115540670 AATTCTTCTCCCACTGACATTGG - Intergenic
1016086969 6:139926335-139926357 CGTACTTCTGCCACGGACTTTGG + Intergenic
1019755141 7:2763266-2763288 AGCACTCCTCCCACGGGCCTGGG - Intronic
1021706612 7:23374170-23374192 AATAATGCTCCCATGAACATGGG - Intronic
1030364818 7:108633458-108633480 AGTACTGCTGCAATGAACATGGG + Intergenic
1034073616 7:148211058-148211080 AGTTCTGCTCCCGGGGACCTTGG - Intronic
1046726704 8:117682819-117682841 AGTAATGTTGCCATGGACATGGG - Intergenic
1049732947 8:144188306-144188328 ACTGCTGCTCCCAGGGCCATGGG - Intronic
1052702725 9:31958349-31958371 AATACTGCTGCAACGAACATGGG - Intergenic
1188509946 X:30924951-30924973 ACTAGTGCTGCAACGGACATGGG - Intronic
1195680699 X:107543919-107543941 AATAGTGCTGCCACGAACATGGG - Intronic
1197538086 X:127716727-127716749 AGTACTGCTGTAATGGACATGGG - Intergenic
1200798224 Y:7361338-7361360 AGTAGTTCTGCCATGGACATGGG + Intergenic