ID: 1134243798

View in Genome Browser
Species Human (GRCh38)
Location 16:12524875-12524897
Sequence CCCTGCCAGCATTTTTTTCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 493
Summary {0: 1, 1: 0, 2: 5, 3: 40, 4: 447}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134243788_1134243798 21 Left 1134243788 16:12524831-12524853 CCCTTCTTCGTGTAAGTACTGCT 0: 1
1: 0
2: 0
3: 4
4: 93
Right 1134243798 16:12524875-12524897 CCCTGCCAGCATTTTTTTCTCGG 0: 1
1: 0
2: 5
3: 40
4: 447
1134243793_1134243798 -2 Left 1134243793 16:12524854-12524876 CCCACGGACATGGGCCGCCAGCC 0: 1
1: 0
2: 0
3: 5
4: 73
Right 1134243798 16:12524875-12524897 CCCTGCCAGCATTTTTTTCTCGG 0: 1
1: 0
2: 5
3: 40
4: 447
1134243789_1134243798 20 Left 1134243789 16:12524832-12524854 CCTTCTTCGTGTAAGTACTGCTC 0: 1
1: 0
2: 1
3: 3
4: 60
Right 1134243798 16:12524875-12524897 CCCTGCCAGCATTTTTTTCTCGG 0: 1
1: 0
2: 5
3: 40
4: 447
1134243794_1134243798 -3 Left 1134243794 16:12524855-12524877 CCACGGACATGGGCCGCCAGCCC 0: 1
1: 0
2: 1
3: 12
4: 129
Right 1134243798 16:12524875-12524897 CCCTGCCAGCATTTTTTTCTCGG 0: 1
1: 0
2: 5
3: 40
4: 447

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134243798 Original CRISPR CCCTGCCAGCATTTTTTTCT CGG Intronic
900686676 1:3953178-3953200 GCCAGCCAGCATTTTGATCTTGG - Intergenic
900837052 1:5013078-5013100 CTCTGCCAGCATTTTGATCTGGG + Intergenic
901082823 1:6593118-6593140 TCCTGCCAGCACATGTTTCTGGG - Exonic
902982597 1:20136519-20136541 CCCTGCCAGCATCTTGATCTTGG + Intergenic
903344473 1:22675628-22675650 CCGTCCCAGCATCTCTTTCTAGG + Intergenic
903482156 1:23661625-23661647 ATCTGCCAGCACTTTGTTCTTGG - Intergenic
903649110 1:24912300-24912322 CCCTGCCTTCTTTTCTTTCTGGG - Intronic
903849190 1:26296112-26296134 CCCTGCCAGAAGTTCTTCCTGGG - Intronic
903909339 1:26710983-26711005 ATCTGCCAGCATTTTGATCTTGG - Intronic
905002691 1:34685562-34685584 CCCTGTCACCATTTTGATCTTGG - Intergenic
905867878 1:41386125-41386147 CCCTGCCAGGAGTGTCTTCTGGG + Intergenic
906622980 1:47299691-47299713 CCCTACCACCAATTTTTTGTAGG + Intronic
906771394 1:48488139-48488161 CCCTGCCAACACCTTTGTCTTGG + Intergenic
906891827 1:49724856-49724878 CACTGCCAGAATTTTGATCTTGG + Intronic
906920786 1:50062378-50062400 CCATGCCATCATATTTATCTGGG + Intronic
907281880 1:53353087-53353109 CCCTGTGCCCATTTTTTTCTTGG + Intergenic
907703494 1:56812971-56812993 CCCTGCTAGCATCTTGATCTTGG - Intronic
907914159 1:58853381-58853403 CCCAGCCTACATTATTTTCTGGG - Intergenic
908077988 1:60542316-60542338 CCCTGCCAGCATGTTGATCTTGG - Intergenic
908146655 1:61253287-61253309 CCGTGCCAGAATTTTGTTCTTGG + Intronic
908314088 1:62915782-62915804 CCCTGCCAGCCCCTTGTTCTTGG + Intergenic
908526331 1:64991317-64991339 CCCTGCCAGCATCTTGATCTTGG - Intergenic
908807432 1:67945775-67945797 CCCTGCCAACAATTTGATCTTGG + Intergenic
909248738 1:73325528-73325550 TCCTGTGAGCATTTTTTTGTAGG + Intergenic
909434180 1:75620928-75620950 TACTGCCTACATTTTTTTCTAGG + Intergenic
911240717 1:95462876-95462898 ATCTGCCAGCATTTTAATCTTGG - Intergenic
911384971 1:97163559-97163581 ACCTGCCAGCACTTTGATCTTGG - Intronic
912042628 1:105411353-105411375 CCGTGAAACCATTTTTTTCTAGG - Intergenic
915866702 1:159508550-159508572 TATTGGCAGCATTTTTTTCTGGG - Intergenic
916364933 1:164015426-164015448 ACCTGCCAGCATCTTGATCTTGG + Intergenic
917417613 1:174826998-174827020 CCCTGCCAACATCTTGATCTTGG - Intronic
917753498 1:178076109-178076131 CCCTGCCAGCATGCTGATCTAGG + Intergenic
918577847 1:186085315-186085337 CCCTGCCAGCACCTTGATCTTGG - Intronic
918906548 1:190503773-190503795 CCATGCAAGCATTTTCTTTTGGG - Intergenic
920003562 1:202815911-202815933 CCATTCCAGCATTTATCTCTGGG - Intergenic
920161991 1:204005658-204005680 GCATGGCAGCATCTTTTTCTGGG - Intergenic
920243156 1:204568535-204568557 ACCTGCAAGCATTTTTCTCTGGG - Intergenic
920743063 1:208599588-208599610 CTCAGCCAGAATTGTTTTCTAGG + Intergenic
922015357 1:221639894-221639916 TCCTGTTATCATTTTTTTCTTGG - Intergenic
923153130 1:231252630-231252652 CCATGCCCTCATTTTTTTCCTGG + Intronic
923514986 1:234689315-234689337 ACCTGCCAGCATCTTGATCTGGG - Intergenic
923549362 1:234950060-234950082 CCCCCCCAGCTTTTTTTTTTTGG - Intergenic
923982148 1:239337155-239337177 CCCTGCCACCACTTTTTGTTTGG - Intergenic
924131793 1:240916742-240916764 TCCTGCCAGCACCTTGTTCTTGG + Intronic
1063358885 10:5431469-5431491 GCCTACATGCATTTTTTTCTTGG + Intronic
1063988915 10:11538198-11538220 TCTTGTCAGCATTTGTTTCTAGG - Intronic
1064289895 10:14023967-14023989 CCCTCCCCACTTTTTTTTCTGGG + Intronic
1064623845 10:17242133-17242155 CCCTGCCAGCACCTCTATCTTGG - Intergenic
1064714361 10:18161451-18161473 CCCTACCAGCTTTTCCTTCTTGG + Intronic
1064919901 10:20504947-20504969 CCCTGCCAACACCTTGTTCTTGG - Intergenic
1065277066 10:24096158-24096180 CCATGCCTGCTTCTTTTTCTGGG + Intronic
1065278851 10:24114366-24114388 CTCAGTCAGCATTTTTTTTTTGG - Intronic
1065491272 10:26284143-26284165 CTCTGACAGCATTTGTTTATTGG + Intronic
1065511457 10:26482647-26482669 ATCTGGCAACATTTTTTTCTAGG - Intronic
1065637997 10:27751114-27751136 CCCTGCCAGCACCTTGATCTTGG - Intergenic
1066405074 10:35110623-35110645 CCCTACCAGCATCTTGATCTTGG - Intergenic
1066618543 10:37320968-37320990 CCCAGGTAGCATTTTTCTCTTGG - Intronic
1067537546 10:47124978-47125000 ATCTGCCAGCATTTTGATCTTGG + Intergenic
1067815049 10:49467861-49467883 CCCAGCCAGTAATTTTTTATTGG + Intronic
1068390693 10:56392438-56392460 CCCTGCCAGCACCTTGATCTTGG + Intergenic
1069198196 10:65580880-65580902 CCTTTTCAGCATTTTATTCTGGG + Intergenic
1069517522 10:69090460-69090482 CCCTGCCAGCACCTTGATCTTGG - Intronic
1070277052 10:75017335-75017357 CCCGGCCTCTATTTTTTTCTAGG - Intronic
1071161601 10:82752814-82752836 ACCTGCCAGCACTTTGATCTTGG + Intronic
1072045987 10:91655706-91655728 CCCGGCCAACAATTTTTTATTGG + Intergenic
1072086388 10:92083717-92083739 CCTTGCCAGCATTCTTTTCCTGG - Intronic
1072224210 10:93353049-93353071 CGCTGCCAGCACTCATTTCTCGG + Intronic
1073116061 10:101092579-101092601 CCCAGCCTACATTGTTTTCTTGG + Intronic
1073913350 10:108372815-108372837 CAATGCCAGCTTTTTTTTTTTGG + Intergenic
1074578776 10:114696298-114696320 ACCTGCCATCATTTTGGTCTTGG - Intergenic
1074896785 10:117784236-117784258 CCTTGCGAGCCTTTCTTTCTGGG + Intergenic
1075414992 10:122255979-122256001 CACTGCCAGCATCCTTTGCTTGG + Intergenic
1075545822 10:123353758-123353780 CCCTGCCATATTTTTTTTCCAGG + Intergenic
1075745073 10:124721418-124721440 CTCTGCCAGCCTTGTTTGCTGGG - Intronic
1076452771 10:130568176-130568198 CCCTGTTAGCATTTCTTTGTTGG + Intergenic
1078428198 11:11268169-11268191 CCCTGCCAACATCTTGATCTTGG + Intergenic
1078519299 11:12050665-12050687 TCCTGCCAGCACATTTTTCTAGG - Intergenic
1079162039 11:18004349-18004371 TCCTGACAGCCTTTTATTCTGGG + Intronic
1079513096 11:21234185-21234207 CCATGCTTGCATTTTTCTCTGGG - Intronic
1079531782 11:21462968-21462990 TCCTGGCCACATTTTTTTCTTGG - Intronic
1079841560 11:25407632-25407654 AGCTGCTAACATTTTTTTCTGGG + Intergenic
1080125939 11:28733861-28733883 CCCTACCAACATCTTGTTCTTGG + Intergenic
1081403600 11:42670358-42670380 CCCTGCTGGCATTTTGATCTTGG + Intergenic
1081539133 11:44017432-44017454 CTATGCCAGCACTTTTTTCAGGG - Intergenic
1081891732 11:46548347-46548369 TCCGGACAGCATTCTTTTCTGGG + Exonic
1083630038 11:64090696-64090718 CCCTGCCCCCATTTTAGTCTTGG - Intronic
1083806239 11:65075893-65075915 CACTGCCAGCTCCTTTTTCTTGG - Intronic
1084509689 11:69595462-69595484 CCCTGCCAACACTTTGATCTTGG + Intergenic
1085170257 11:74443743-74443765 CCTTCCCAGCATTCTTATCTAGG + Intergenic
1085196615 11:74676482-74676504 CCCTGCCAGGAGGTCTTTCTAGG + Intergenic
1088724543 11:112622549-112622571 CCCTGCCAGCACCTTGATCTTGG + Intergenic
1089136679 11:116254835-116254857 CCCTGACAGCATCTTGATCTTGG - Intergenic
1089264528 11:117249665-117249687 ACCTGCCAGCATCTTTATGTCGG - Intronic
1091662266 12:2393235-2393257 CCCAGCCTGCATTTTCTGCTTGG - Intronic
1092897432 12:13026282-13026304 CCCTGCCAGTATTCTCTTCTGGG + Intergenic
1093994526 12:25627507-25627529 CCCTTCCAGCACTTTTCTCTAGG - Intronic
1094273979 12:28647855-28647877 CCCTGCCAGCACCTTGATCTTGG - Intergenic
1096752519 12:53770597-53770619 ACTTGCCATCATTTTTTTATTGG - Intergenic
1098114881 12:67164533-67164555 GCTTGTCAGCATTTTGTTCTAGG + Intergenic
1098155727 12:67596237-67596259 CCCTTCCAACTTTGTTTTCTGGG + Intergenic
1099751755 12:86782860-86782882 CCCCGCCAGCATCTTAATCTTGG + Intronic
1100007625 12:89913085-89913107 CCATGCCAACATTTATTTTTTGG + Intergenic
1100534742 12:95497727-95497749 CCTTGCCAACACTATTTTCTGGG + Intronic
1101473355 12:105020179-105020201 CCTTGACAGCTTTATTTTCTTGG + Exonic
1101750087 12:107576377-107576399 CCCTGCCAGCAGCTTGATCTGGG - Intronic
1103426251 12:120837389-120837411 AACTGGCAGCATTTTTTTATTGG + Intronic
1104571869 12:129933196-129933218 CCCTGCCAGCACCTTGGTCTTGG - Intergenic
1104799392 12:131543574-131543596 TCCCCACAGCATTTTTTTCTGGG + Intergenic
1105312968 13:19229750-19229772 CCCTGTAAGCATTTTCTTCTGGG + Intergenic
1105965557 13:25380920-25380942 TCCCTCCAGCATTTTTTTCAGGG + Intronic
1105968426 13:25405422-25405444 CCCTTCATTCATTTTTTTCTGGG + Intronic
1106681310 13:32011432-32011454 CCCTGCCAGCACCTTGATCTGGG - Intergenic
1106715808 13:32386917-32386939 CCCTGCCAACACTTTGATCTTGG - Intronic
1107350050 13:39504502-39504524 ACCTGCCAGCATCTTGATCTTGG - Intronic
1107903397 13:45040467-45040489 CCCTGCCAAGTTTTTGTTCTAGG - Intergenic
1108539910 13:51431723-51431745 CCCCGGAACCATTTTTTTCTTGG - Intronic
1108629464 13:52267512-52267534 CCTTGCCAGCATGTTATTTTTGG + Intergenic
1108656592 13:52538976-52538998 CCTTGCCAGCATGTTATTTTTGG - Intergenic
1108736210 13:53285597-53285619 CCCTGCCAGCACTTTGATCTTGG + Intergenic
1109381934 13:61573809-61573831 CCTTGCCAGCAATTTGATCTTGG + Intergenic
1110544198 13:76737941-76737963 CCCTGCCAACATCTTGATCTTGG + Intergenic
1110675232 13:78234955-78234977 CCCCGCCGGCTTTTTTTTCCTGG + Intergenic
1111058515 13:82981399-82981421 CCCTGCCTGCACTTTGATCTTGG + Intergenic
1112801611 13:103117074-103117096 AACTGTTAGCATTTTTTTCTGGG - Intergenic
1113075230 13:106461488-106461510 CACAGCAAGCATTTTTTGCTAGG - Intergenic
1113864760 13:113513773-113513795 TCCTGCCAGATTTTTTTTATTGG - Intronic
1114585039 14:23803606-23803628 ACCTGCCAGCACTTTGATCTTGG + Intergenic
1115029193 14:28774396-28774418 ACCTGGCAGCGTTGTTTTCTCGG + Intronic
1115753907 14:36515314-36515336 CCCTCCCAGCACTTTCCTCTAGG - Intergenic
1116633358 14:47361356-47361378 CCCTGCCAGCACCTTGATCTTGG + Intronic
1116775118 14:49170590-49170612 TCCTGCCTATATTTTTTTCTAGG - Intergenic
1117286977 14:54295267-54295289 CCATACCAGCATCTATTTCTAGG + Intergenic
1117671466 14:58111047-58111069 CCCAGCCAGGATTTTTTTAATGG + Intronic
1118583267 14:67326118-67326140 CCCGGCCAGCATCTTTCTTTTGG + Intronic
1118997779 14:70852900-70852922 TCCTGCCAGCATCTTGATCTAGG + Intergenic
1119267116 14:73269454-73269476 CACTGGCAGCATTTTTTTCTTGG - Intronic
1120402973 14:84055611-84055633 ACCTGCCAGCATCTTGATCTTGG - Intergenic
1120999582 14:90441979-90442001 CCCTGCCATGTTTTTTGTCTCGG - Intergenic
1121500462 14:94431884-94431906 CCTTGCCAGCATTTTGTTATTGG + Intergenic
1122028586 14:98895927-98895949 CCATGCCAGCACCTTGTTCTTGG - Intergenic
1124689539 15:31810575-31810597 CCCTGCCAGCACCTTCATCTGGG + Intronic
1124986090 15:34616541-34616563 CCATGGCAGCATTTTGTTCAAGG - Intergenic
1125091911 15:35802812-35802834 ACCTGCCAGCACTTTTATCTTGG - Intergenic
1125365122 15:38905335-38905357 ACCTGCCAGCATCTTTATTTTGG - Intergenic
1125701425 15:41688843-41688865 CCCTGCCAGAACTTTGATCTTGG - Intronic
1126239060 15:46420058-46420080 CCCTGCCAGCATCTTCACCTTGG + Intergenic
1127013820 15:54660431-54660453 TTCTGCCAGCATTGTATTCTAGG - Intergenic
1128334918 15:66779580-66779602 CCCTGCCACCCTGTTCTTCTGGG + Intronic
1128572286 15:68742694-68742716 CCCGGCCAGCATTTCTTAATAGG - Intergenic
1128679099 15:69634391-69634413 CTCTGCCAGTTTTTTTTGCTGGG - Intergenic
1129868797 15:78928104-78928126 TCTTGCCAGCATTGTTTTTTGGG - Intronic
1130533656 15:84767319-84767341 CCCGGCCAACACTGTTTTCTAGG + Intronic
1131529833 15:93181611-93181633 CCCTGCCAACACCTTGTTCTTGG + Intergenic
1131796139 15:96018654-96018676 GCCTGCCAACAATGTTTTCTTGG - Intergenic
1131825688 15:96321597-96321619 CCCTGCCAGCCTTTACTCCTTGG + Intergenic
1132053255 15:98629258-98629280 CCATGCCAGCTTTCTCTTCTGGG - Intergenic
1132384554 15:101390751-101390773 CCCTGCCAGCACCTTGGTCTTGG + Intronic
1132421900 15:101677163-101677185 CCCTTACAACATTTATTTCTGGG + Intronic
1132901887 16:2260833-2260855 CCCAGCCAACAATTTTTTTTGGG - Intronic
1133392089 16:5418896-5418918 CCCTTCCTGCATTGTTTGCTTGG - Intergenic
1133750393 16:8720785-8720807 GTCTGCCAGCACTTTTGTCTTGG + Intronic
1134243798 16:12524875-12524897 CCCTGCCAGCATTTTTTTCTCGG + Intronic
1134275158 16:12769478-12769500 CCCTGCCAGCATTTTCTACGTGG - Intronic
1134782493 16:16911068-16911090 CCCTGCCAACACTTTGATCTTGG - Intergenic
1135119930 16:19756985-19757007 ATCTGCCAGCACTTTTATCTTGG + Intronic
1135141096 16:19922715-19922737 ATCTGCCAGCATTGTTCTCTTGG + Intergenic
1136121442 16:28138075-28138097 CCCTGCCGGCATTCTTTCCTGGG - Intronic
1136590627 16:31215757-31215779 CCCGTCCAGGATGTTTTTCTGGG + Intronic
1138024988 16:53515254-53515276 CCCTGCCAGCACCTTGATCTTGG + Intergenic
1138065188 16:53933498-53933520 CCATGCCAGCAATGTTTTGTGGG - Intronic
1138135859 16:54522093-54522115 CCCTGTCAGCATTTGTGTTTTGG - Intergenic
1141213355 16:82001516-82001538 CCCTCCCCGCATTTCTTTCAAGG + Intronic
1141405044 16:83785255-83785277 ATCTGCCAGCATCTTATTCTTGG - Intronic
1141611678 16:85185159-85185181 CTCTGGCAGCATCTTTGTCTTGG + Exonic
1141687922 16:85580874-85580896 CCCTGCCAGCACCTTGATCTTGG + Intergenic
1142332803 16:89466093-89466115 TTCTGCCAGCATCTTTTTCTGGG - Intronic
1142901794 17:3016874-3016896 CACTGCCAGGATTTGTATCTGGG - Intronic
1143189973 17:5033894-5033916 TCCTGCCAGCACCTTCTTCTGGG - Exonic
1143310667 17:5985825-5985847 CCCTGCCAGCATCTTGATTTTGG + Intronic
1144037830 17:11383236-11383258 CCCTGTCAGCCCTTTTTTATAGG + Intronic
1144356794 17:14454172-14454194 CCCAACCAGCTTTTATTTCTAGG - Intergenic
1144455102 17:15412379-15412401 CCCTGCCAGCATCTTGATCTTGG - Intergenic
1145118252 17:20232092-20232114 CACTGATGGCATTTTTTTCTTGG + Intronic
1146084258 17:29813085-29813107 CCCTGCCCCCATTTTTTTATTGG - Intronic
1146484239 17:33230434-33230456 ACCTGCCACCACTTTTGTCTTGG + Intronic
1148162425 17:45458273-45458295 CCCAGGGAGCAGTTTTTTCTTGG + Exonic
1148919636 17:51019201-51019223 CCCTGCCAGCACCTTGATCTTGG + Intronic
1150212320 17:63447921-63447943 CCCTGCCAGCAGTGTTCTCAAGG + Intergenic
1150393660 17:64804934-64804956 CCCAGGGAGCAGTTTTTTCTTGG + Intergenic
1150966813 17:69979991-69980013 CCATGCCAGTCTTTTTTTTTTGG + Intergenic
1151171799 17:72252871-72252893 CCCTGCAAGCATTGCTTTGTTGG - Intergenic
1151183049 17:72343512-72343534 CTCTGCCAGTTTTTTTCTCTTGG + Intergenic
1151521323 17:74632400-74632422 CTCTCCCAGCATTCTTTTCCGGG + Intergenic
1152625405 17:81385948-81385970 CCCGGCCAGCCTGTTTCTCTGGG - Intergenic
1153184030 18:2467245-2467267 CCCTGCCAGCACTTTGATTTTGG + Intergenic
1153461880 18:5344088-5344110 CTCTGCTAGCATTTTTTATTGGG - Intergenic
1155095546 18:22551778-22551800 CAATGCCAGCATTGTTCTCTCGG - Intergenic
1157438275 18:47689685-47689707 TAATGCCATCATTTTTTTCTGGG + Intergenic
1158348296 18:56538162-56538184 CCTTGCCAGCACTTTGATCTTGG + Intergenic
1158403301 18:57140177-57140199 CCCTGCCAACATCTTGATCTTGG + Intergenic
1158827014 18:61233386-61233408 CCTTGACAGCCTTATTTTCTGGG - Intergenic
1158977586 18:62726312-62726334 CCTTGCCTGCTTTTTTTTTTTGG + Intronic
1159683924 18:71392750-71392772 CGCTGCCAGCATGGTATTCTTGG + Intergenic
1160245210 18:77153167-77153189 CTCAGCCAGCACTGTTTTCTGGG - Intergenic
1163319022 19:16561480-16561502 GCCTGCTACCATTTATTTCTCGG + Intronic
1163369075 19:16892091-16892113 CCCTGCCAGCATCTCTGGCTCGG + Exonic
1164290551 19:23865147-23865169 CACTGCCAGCATATTTGTCCTGG - Intergenic
1165529734 19:36387907-36387929 CCCAGCCAGTATTCTTTTATAGG + Intronic
1165860123 19:38905049-38905071 CCCTTCCTGGATTTTCTTCTAGG + Exonic
1167445830 19:49537066-49537088 CCGAGCCAGCATCTTTTTGTAGG - Exonic
1168264997 19:55217954-55217976 CCCTGCCCACATTTTCATCTTGG - Intergenic
1168463518 19:56582822-56582844 CCCTGCCAGCACCTTGATCTTGG + Exonic
1168480132 19:56713135-56713157 TCCGGCCAGCAGTTTTTTCATGG + Intergenic
1168570820 19:57467580-57467602 CACTGCCAGCATCTTAATCTTGG + Intronic
925047117 2:780841-780863 CCCTGCCAGCAACTTGATCTTGG + Intergenic
925701463 2:6642920-6642942 ATCTGCCAGCATTTTGATCTTGG - Intergenic
926130454 2:10300716-10300738 CCCTGCCAACACTTTGATCTTGG + Intergenic
926302622 2:11615321-11615343 CCCTGTCTGCATGTCTTTCTTGG + Intronic
926551383 2:14305710-14305732 CCCTGCCAACATCTTGATCTTGG + Intergenic
927259996 2:21078652-21078674 CCCTGCCAGCATCTTGATCTTGG + Intergenic
927406141 2:22769870-22769892 CCCTGCCAGCAACTTTTTCTTGG + Intergenic
929880329 2:45831089-45831111 TCTTCCCAGCATTCTTTTCTCGG - Intronic
931447090 2:62335829-62335851 CCCTGACAGCATTTTGATCTTGG + Intergenic
931747191 2:65300571-65300593 CTCTGCCAGCACATATTTCTAGG + Intergenic
932044816 2:68337820-68337842 CCCTGCCAACACTTTGTTTTAGG - Intergenic
932968352 2:76505577-76505599 CCCTGCCACCTTGTTTCTCTGGG - Intergenic
933185118 2:79269875-79269897 CTCTGACAGCATTTCATTCTAGG - Intronic
934666639 2:96176156-96176178 TCCTGCCAGCATGTATTTCTTGG + Intergenic
935066880 2:99656834-99656856 CCTAGGCAGCATTTATTTCTAGG - Intronic
935384959 2:102490351-102490373 CCCTGCCCACATCTTGTTCTTGG - Intronic
936367847 2:111876268-111876290 TCCTGCAAGTATTTTTTTTTTGG - Intronic
937547679 2:123043822-123043844 CCCTGCCAGCACCTTGATCTTGG - Intergenic
937568702 2:123330781-123330803 CCCTGCAATCATCTTTTTATTGG - Intergenic
938662185 2:133498515-133498537 CCCTGCCGCCCTTTTCTTCTTGG - Intronic
938813037 2:134871172-134871194 CCCTGCCAGCACCTTGATCTTGG - Intronic
939723451 2:145683963-145683985 CCTTGCCAGCACTTTGATCTTGG - Intergenic
939967810 2:148627727-148627749 ACCTGCCAGCACTTTGATCTTGG - Intergenic
940067357 2:149644871-149644893 CCCTCCCAGAATTTTATTCCTGG - Intergenic
940075954 2:149742692-149742714 ACCTGACAGCATCTTTATCTTGG - Intergenic
941052036 2:160746123-160746145 CCTTGCCAGCTATTTCTTCTTGG + Intergenic
942650188 2:178158313-178158335 ATCTGCCAGCACTTTTATCTTGG - Intergenic
942858261 2:180578331-180578353 AGGTGCCAGTATTTTTTTCTTGG + Intergenic
943568600 2:189545488-189545510 CCCTGCCAACATCTTGATCTTGG - Intergenic
944131510 2:196352467-196352489 CTCTGCCAGCATTCCTTTCCAGG - Intronic
944274991 2:197826055-197826077 ACCTGCCAGTATTTCCTTCTCGG + Intronic
944337228 2:198549717-198549739 CGCTGCCAGCACTCATTTCTTGG - Intronic
945142046 2:206697347-206697369 TCCTTCTAGAATTTTTTTCTTGG + Intronic
947383474 2:229567501-229567523 CACTACCAGCTTTCTTTTCTGGG - Intronic
947639615 2:231699642-231699664 CCCTTCCAGCATCTTTCTCCTGG - Intergenic
948445888 2:238032634-238032656 CCCAGCCAGCATGTTTTTGGGGG - Intronic
1171225792 20:23441052-23441074 CCCGGCCAGCTCTTTTTCCTTGG + Intronic
1172304287 20:33870513-33870535 CCCAGCCAGCCTTGTTCTCTGGG - Intergenic
1172986007 20:38990268-38990290 CATTGCCATCATATTTTTCTTGG - Intronic
1173233052 20:41217280-41217302 CCCATCCCTCATTTTTTTCTAGG - Intronic
1173817224 20:45997576-45997598 CCCTGCCAGCACCTTGATCTAGG + Intergenic
1174823174 20:53745036-53745058 CCCAGCCTGCTTTTGTTTCTTGG - Intergenic
1174917651 20:54670164-54670186 CCCTGCCATCATTCTTTTTGAGG - Intergenic
1176908670 21:14535815-14535837 CCCTGCCAGCACCTTGATCTTGG + Intronic
1177243962 21:18498178-18498200 CCCTGCCAGCACCTTGGTCTTGG - Intergenic
1177595578 21:23237551-23237573 AACTGCCAGCATTTTTAGCTAGG + Intergenic
1177942480 21:27428480-27428502 ACCTGCCAGCATCTTGATCTTGG + Intergenic
1178410434 21:32359353-32359375 CATTGCCAGCATTTTTTTCTAGG - Intronic
1178432271 21:32527009-32527031 ACCTGCCTGCATCATTTTCTAGG - Intergenic
1178995191 21:37392817-37392839 TCCTGCCAACACTTTTATCTTGG - Intronic
1179257313 21:39727976-39727998 ACTTACCAGCATTTTTCTCTAGG - Intergenic
1180232910 21:46438159-46438181 CTCTGCTGCCATTTTTTTCTTGG - Exonic
1181264257 22:21621185-21621207 CACTCCCAGCCCTTTTTTCTTGG - Intronic
1181660393 22:24342844-24342866 CCCGACCCGCCTTTTTTTCTTGG - Intronic
1181677214 22:24463289-24463311 CCCTGCCAACATCTTGATCTTGG + Intergenic
1182152075 22:28034820-28034842 CCCTGCCAGCATCTGTTCCAGGG + Intronic
1182322453 22:29486982-29487004 CTCTGCAAGCATTCATTTCTTGG + Intronic
1182471776 22:30553359-30553381 CCCAGCCTGCATTGGTTTCTTGG + Intergenic
1184163677 22:42714812-42714834 CCCTGAGTGCATTTTTCTCTTGG - Intronic
953221714 3:40977770-40977792 CCCTCCCACCATTTTCATCTGGG - Intergenic
953442164 3:42927634-42927656 CCCTGCCAGCACCTTGATCTTGG + Intronic
954486435 3:50857149-50857171 CCTTGCCAGATTTTTGTTCTAGG + Intronic
954694603 3:52415101-52415123 CTTTGACAGCATTTGTTTCTGGG - Intronic
955238169 3:57157888-57157910 CACTGCCAGCATTTTTTAAAGGG + Intronic
957941315 3:87007890-87007912 CTCTGCCAGCACTTTGATCTTGG + Intergenic
957955060 3:87175824-87175846 ACATGTCAGCATTTTTTTTTTGG + Intergenic
958415250 3:93866286-93866308 TCCTGTCAGCCTTTATTTCTAGG - Intergenic
958985209 3:100772781-100772803 CCCAGCCTGCATTTTATTTTGGG - Intronic
959047709 3:101492678-101492700 CCCTGCCAGCACCTTCATCTTGG + Intronic
959230779 3:103648092-103648114 CCCTGCCAGCACTATAATCTTGG - Intergenic
960871228 3:122251991-122252013 CCCTGCCATCATTTTTAACCTGG - Intronic
962227862 3:133631470-133631492 TTCTGCTTGCATTTTTTTCTAGG + Intronic
962716405 3:138129497-138129519 CCCTGCCAGCAGTTTGATATTGG + Intronic
963285213 3:143428426-143428448 CCTTGCCAGCATTTTTTCTGGGG - Intronic
963489242 3:145978281-145978303 CCCTTCCCGCATCTTCTTCTTGG + Intergenic
964588620 3:158336254-158336276 CCCTGGCTGCCTTTCTTTCTTGG + Intronic
965007436 3:163043838-163043860 ACCTGCCAGCATTTTCCTCATGG + Intergenic
965806606 3:172548566-172548588 CCCTGCCAGCACCTTGATCTTGG + Intergenic
966077906 3:175960961-175960983 CACTGCCAGCACTTTGATCTTGG - Intergenic
966397047 3:179514755-179514777 CCCTGCCAGCACCTTCATCTTGG + Intergenic
967270081 3:187725846-187725868 CCGTGCCACCACTTGTTTCTTGG - Intronic
967852617 3:194093547-194093569 CTGTAACAGCATTTTTTTCTGGG + Intergenic
968038704 3:195570464-195570486 TCCTCCCAGCATTCCTTTCTTGG + Intronic
968595655 4:1481248-1481270 CCTGGCCAGCATTTTTTTGGTGG - Intergenic
968896402 4:3406355-3406377 CCTTTCCAGGACTTTTTTCTTGG + Intronic
968949152 4:3681472-3681494 CCCTGCCAGCATCTTCGTTTTGG + Intergenic
969072092 4:4547675-4547697 CCCTGCCAGCATCTTGATTTTGG + Intergenic
970712309 4:18877634-18877656 CCTTGCCAGCATCTTGATCTTGG - Intergenic
970858538 4:20675966-20675988 ATCTGCCAGCATTTTGATCTTGG - Intergenic
971478979 4:27097726-27097748 CCCTGCCAACATCTTGATCTTGG + Intergenic
972930707 4:44068576-44068598 CCCTGCCAACATCTTGATCTTGG + Intergenic
973156114 4:46954773-46954795 GCCTGCCTGCAGTTATTTCTAGG + Intronic
973253800 4:48088152-48088174 CCTTGCCAATATTTTATTCTAGG - Intronic
973283692 4:48390553-48390575 CACTGTCTGCATTTTTTTCCTGG - Intronic
973729133 4:53806248-53806270 CCCTGCCAGCATCTTGATTTGGG - Intronic
973736007 4:53872292-53872314 ACCTGCCAGCACTTTGATCTTGG + Intronic
973766415 4:54167396-54167418 CCCTGCCAGCACCTTAATCTTGG - Intronic
973847714 4:54929834-54929856 CCATGCAAGCACTTCTTTCTAGG + Intergenic
974337736 4:60572111-60572133 ACCTGCCAGCATCTTGATCTTGG + Intergenic
974673960 4:65066384-65066406 CCCTGTCAGCATTTCTTTTCTGG - Intergenic
976118453 4:81753998-81754020 ACCTGCCTGCATTTTGATCTTGG - Intronic
976584767 4:86783502-86783524 GGCTGCCAGCATTTTTTGGTTGG + Intronic
979615591 4:122739158-122739180 ACCTGCCAGCATTTTGATTTTGG + Intronic
980220038 4:129902199-129902221 CCCTGCCAGTGTTTCTCTCTTGG - Intergenic
980719786 4:136680298-136680320 CCCTGCTAGTTTTTTTTTCCTGG + Intergenic
981645594 4:146995211-146995233 CCTTGCCAGCATCTCTTTTTTGG - Intergenic
981881662 4:149620260-149620282 CGCTGCCAGCAACTTTATCTTGG + Intergenic
982140940 4:152317315-152317337 CCCTGCCACCTTCTCTTTCTAGG - Intergenic
982293474 4:153803420-153803442 CCCTGCCAGCACTCTGATCTTGG - Intergenic
983076760 4:163335808-163335830 TACTGAAAGCATTTTTTTCTTGG - Intronic
983480599 4:168269301-168269323 CCCGGCCAACATTTTTATTTTGG - Intronic
984859861 4:184228372-184228394 CCCTGCCAGCACTTTGATTTTGG - Intergenic
984970538 4:185185174-185185196 CACTGCCAGCACTCATTTCTTGG - Intronic
985219802 4:187692366-187692388 CCAAGCCAGCAGATTTTTCTAGG + Intergenic
985382713 4:189412485-189412507 CCCTGGCAGTCTTTTTTTCCCGG + Intergenic
986027144 5:3861547-3861569 CCCTGCCAGAACTTTAATCTTGG - Intergenic
986309455 5:6541435-6541457 CCCTGCCACCATTTTGCACTGGG + Intergenic
986528284 5:8704431-8704453 ACATGCTAGCATTTTTTTCTAGG + Intergenic
986692438 5:10324835-10324857 CCCTGCCAGCACCTTGATCTTGG - Intergenic
986859730 5:11912300-11912322 CCCTGCCAGCATCTTGATCTTGG + Intergenic
986986307 5:13504388-13504410 CCCTGCCAGCACCTTGATCTTGG - Intergenic
987033625 5:13998174-13998196 ACCTGCCAGCATCTTGATCTTGG - Intergenic
987601871 5:20082903-20082925 CCCTGCCAGCACTTTGATTTTGG + Intronic
988491272 5:31707470-31707492 CCCTGGCAGCACCTTTATCTTGG + Intronic
988673309 5:33405543-33405565 ACCTGCCAGCACTTTGATCTTGG + Intergenic
989513489 5:42315817-42315839 CTCTGCCATCATTTTGTCCTAGG - Intergenic
990063952 5:51689002-51689024 CCCTGCCAGCCCTTTGATCTTGG + Intergenic
990599581 5:57344130-57344152 CCCTGCCAGCTTTCCTTTCTTGG + Intergenic
990806367 5:59667219-59667241 CCCTCCTAGAATTTTTTTTTGGG + Intronic
991177348 5:63704988-63705010 CCCTGCCAGCACTCTGATCTTGG + Intergenic
991359840 5:65808062-65808084 CCCTGCAAGATTTTTTTTATTGG + Intronic
991561113 5:67954507-67954529 CCTTGCCAGCTTCTTTTTCCAGG + Intergenic
992092027 5:73325949-73325971 CCCTGCCAACACTTTGATCTTGG - Intergenic
992158580 5:73978966-73978988 CCCTGCCAACCTGTCTTTCTTGG + Intergenic
992777438 5:80100796-80100818 CCCTCCCAGCACTCTTTTTTTGG - Intergenic
993229705 5:85218397-85218419 CCATGACACCATTTTTTCCTAGG - Intergenic
994029995 5:95130609-95130631 CCCTGCCAACACTTTGATCTTGG - Intronic
994765046 5:103904904-103904926 CCTTGCCAGCATCTGTTTTTTGG - Intergenic
995095023 5:108225623-108225645 CCCTGCCAACACTTTGATCTTGG + Intronic
995115603 5:108474706-108474728 TCCTTTCAGCATTTTTTTGTAGG - Intergenic
995712676 5:115050932-115050954 CCCTGCCAACACTTTGATCTTGG + Intergenic
995915479 5:117240645-117240667 CCATAGCAGCATTTGTTTCTGGG - Intergenic
997178864 5:131807514-131807536 CACTGACAGCAATTTTTGCTGGG - Intronic
997305186 5:132831007-132831029 CCCTGGCAGCTCTGTTTTCTTGG - Intergenic
998213418 5:140218894-140218916 CCCTCCCAGCATATTTTTGGAGG + Intronic
998311764 5:141139411-141139433 CCCTGCCAACACTTTGATCTTGG + Intronic
999631623 5:153577325-153577347 CCCTGCAATCATTTATCTCTGGG + Intronic
999835794 5:155370134-155370156 CCTTGCCATCATTTTTTTGTTGG + Intergenic
1000418578 5:161010921-161010943 TCCTTGAAGCATTTTTTTCTGGG - Intergenic
1001081016 5:168667492-168667514 CCCAGCCTGCAGTTATTTCTAGG - Intronic
1001285054 5:170416728-170416750 CACTGCCAGCACTCATTTCTTGG + Intronic
1001363107 5:171107469-171107491 GCCTGCCATTTTTTTTTTCTTGG + Intronic
1001768635 5:174275644-174275666 CCCTGCCAGCACTTTGATCTTGG - Intergenic
1003302618 6:4898060-4898082 CCATGCCTGGATTTTTTTTTTGG - Intronic
1003990507 6:11482030-11482052 CCCTGCCAACATCTTGATCTTGG + Intergenic
1004235732 6:13873185-13873207 CCCTGCCAACACTTTGATCTTGG + Intergenic
1004606450 6:17199718-17199740 CCCTGCCAGCACCTTGATCTGGG - Intergenic
1005972362 6:30771337-30771359 CCTTGCCAGCACTTTGGTCTTGG - Intergenic
1006552306 6:34834635-34834657 CCTTGCCAGTCTTTTTTCCTTGG + Intronic
1008384027 6:50867116-50867138 TCCTTACAGCAATTTTTTCTTGG - Intergenic
1010376934 6:75181792-75181814 CCCTTCCTGCCTTTTTTTTTTGG - Intronic
1010604330 6:77869574-77869596 CCCTGCCAGCATCTTGGTCTTGG + Intronic
1010870750 6:81035071-81035093 CCCTGCCAGCACCTTTATCTTGG + Intergenic
1011284798 6:85711560-85711582 CCCTGATGGCATTTTTATCTTGG + Intergenic
1011739296 6:90343457-90343479 CCCTGCCAATATCTATTTCTAGG - Intergenic
1014130802 6:117829935-117829957 CACTGCCAGGATTTTTTTTTCGG + Intergenic
1015098714 6:129449312-129449334 ACCTGCCAGCATCTTGATCTTGG - Intronic
1015222031 6:130814809-130814831 CCCTGCCAGCATTTTGATCTTGG + Intergenic
1015312068 6:131777094-131777116 CCCTGACAGCATTCTTCTCTTGG - Intergenic
1015888201 6:137942751-137942773 CCCTGCCAACATCTTGATCTTGG - Intergenic
1016773484 6:147878196-147878218 ACCTGCCAGCATCTTGATCTTGG - Intergenic
1016898585 6:149078629-149078651 CCCTGCCAGCACTTCAATCTCGG - Intergenic
1017035893 6:150266992-150267014 CCCTGCCAACATCTTAATCTTGG - Intergenic
1017333234 6:153224062-153224084 CCCTGCCAGCAGTTTGATCTTGG + Intergenic
1017629561 6:156383171-156383193 TAGTGCCAGCATTTGTTTCTGGG - Intergenic
1017809627 6:157975577-157975599 CCCTGCCAGCACCTTGATCTTGG - Intergenic
1018451676 6:163914409-163914431 CACTGGCAGCATTTTCTTCCTGG - Intergenic
1018696994 6:166398020-166398042 CCCTGCCAGCACCTTGATCTTGG - Intergenic
1018827571 6:167421335-167421357 CTCTGCCAGCATTTCTGTCCTGG + Intergenic
1018957918 6:168423853-168423875 CCCTGCCGGCACTTTGGTCTTGG - Intergenic
1019915679 7:4130675-4130697 CCTTGCCAGCTTTGTTTTCATGG + Intronic
1020173053 7:5859981-5860003 CCCAGCCAGTGTTTTTTTATTGG + Intergenic
1020247181 7:6438923-6438945 CCCGGCCAGAAATTTTTTCTAGG - Intronic
1020402276 7:7792791-7792813 ACCTGCCAGCATCTTGATCTTGG - Intronic
1021262303 7:18473114-18473136 CCCTGTCTGTATTTGTTTCTGGG - Intronic
1021693047 7:23248491-23248513 GCCTGCCCTTATTTTTTTCTGGG - Intronic
1022113984 7:27247136-27247158 CCCTGCCCCCACTTTTTTGTTGG + Intronic
1023288307 7:38642764-38642786 CCCTGCCAGAAGTTCTATCTGGG + Intergenic
1024762027 7:52610417-52610439 CCCTGCCTGCACTTTGATCTTGG - Intergenic
1024775297 7:52777872-52777894 CCGTGCCAGTATTTTTATCTAGG - Intergenic
1025018118 7:55457609-55457631 TGTTGCCAGCATTTTTTTTTTGG + Intronic
1025624510 7:63208283-63208305 CCCGGCCAGCATTTTTTTTATGG - Intergenic
1026113754 7:67478847-67478869 CCTTTCCATCATTTTTTTTTTGG + Intergenic
1026402251 7:70026315-70026337 CACTGCCAGCAGCTATTTCTAGG + Intronic
1026449742 7:70517392-70517414 CCCAGCCATCATTTGATTCTTGG + Intronic
1026503899 7:70966004-70966026 CCCTGCCAACACTTTGATCTTGG + Intergenic
1026544790 7:71312556-71312578 CCCTGCCAGCACCTTCATCTTGG - Intronic
1027201242 7:76065100-76065122 TCCTCCCAGCTCTTTTTTCTCGG - Intronic
1027226419 7:76246770-76246792 CCCTGCTCTCATGTTTTTCTAGG + Intronic
1028403944 7:90456200-90456222 CCCTGCCAGCAATTTGATCTTGG + Intronic
1028759448 7:94479249-94479271 CCCAGCCTGTATTTTTTTGTTGG + Intergenic
1028837521 7:95391542-95391564 CTTCTCCAGCATTTTTTTCTGGG - Intronic
1028922631 7:96323948-96323970 ACCTGCCAGCACTTTGATCTTGG + Intergenic
1029085692 7:98010030-98010052 CCCGGCCAGTGTTTTTTTATTGG - Intergenic
1029394426 7:100297997-100298019 CCCTGCCAACATCTTGATCTTGG + Intergenic
1030656266 7:112171857-112171879 CCCTGCCAGCACCTTGATCTTGG - Intronic
1030721293 7:112874041-112874063 CCCTGCCAACATCTGTTTTTTGG - Intronic
1032597192 7:133253352-133253374 CCCCTCCACCTTTTTTTTCTGGG + Intronic
1032914554 7:136474974-136474996 GCCTTCCAGCATTATTTTATAGG + Intergenic
1034113294 7:148559306-148559328 CTGTGTCACCATTTTTTTCTTGG + Intergenic
1034889510 7:154827643-154827665 CCCTGCCAGCCGTCCTTTCTGGG - Intronic
1035025879 7:155825402-155825424 CCCAGACAGTATTTTTTCCTGGG + Intergenic
1036059106 8:5295013-5295035 CCCTGCCAGCACCTTGATCTTGG + Intergenic
1036446465 8:8825516-8825538 CCCTGCCAGCACCTTGATCTTGG - Intronic
1036746693 8:11414917-11414939 CCCTGCCAGTACTTTGATCTTGG - Intronic
1036959452 8:13227986-13228008 CTCTGCCTCCATTTTTTTATTGG + Intronic
1037729821 8:21515024-21515046 CTCAGTCAGCATTTTTATCTGGG - Intergenic
1037738018 8:21582292-21582314 CCCTGCCAGCACCTTGATCTTGG + Intergenic
1037870225 8:22487326-22487348 CCCAGCCAGCATTTTGTAATAGG - Intronic
1038101045 8:24376068-24376090 CCTTGCTAGCATTTTCTTCTAGG - Intergenic
1038567118 8:28628954-28628976 TCCAGCCAGCATTCTTTCCTTGG - Intronic
1038569413 8:28647686-28647708 TCTTGCCAACACTTTTTTCTAGG + Intronic
1039632021 8:39122517-39122539 ACCTGCTAGCATATTTATCTTGG + Intronic
1040718931 8:50293233-50293255 CCCTGCCAACACTTTGGTCTTGG - Intronic
1041733648 8:61087709-61087731 GCCTGCCAGCATTTTAATCCAGG + Intronic
1042055323 8:64758140-64758162 CTCTGCAAGCCTTTTGTTCTAGG - Intronic
1043100289 8:76036779-76036801 CCCTAGCAGCATTTGTTTTTGGG - Intergenic
1044141905 8:88665983-88666005 CCCTGCCAGCATCTCGATCTTGG + Intergenic
1045333833 8:101180553-101180575 CCCTGCAAGGATTCTTCTCTTGG + Intronic
1045669368 8:104530525-104530547 CCCTGCCAGCACTTTGATGTTGG + Intronic
1045943418 8:107765971-107765993 CCCTGCCAGCACCTTGATCTTGG + Intergenic
1046354762 8:113067770-113067792 CACTGCTAGCACTCTTTTCTTGG - Intronic
1047039191 8:120974081-120974103 CCTTGCCAGCACTTTGATCTTGG - Intergenic
1047621783 8:126615135-126615157 AGATGCCAGCATCTTTTTCTTGG + Intergenic
1048392962 8:133985639-133985661 CCCTGCCATCATTTTTTGTCTGG - Intergenic
1049242144 8:141543469-141543491 CCCTGCCAACACTTTGATCTTGG + Intergenic
1050271565 9:3951432-3951454 CCCTGCTTTCATTTTGTTCTTGG - Intronic
1050389169 9:5120079-5120101 ACCTGCCAGCACTTTTTTCATGG - Intronic
1051148452 9:14055529-14055551 CCCTGCCAGCACTTTGACCTTGG - Intergenic
1051392559 9:16581586-16581608 CCCTGCCAACACTTTGATCTTGG + Intronic
1051518516 9:17957909-17957931 CCCTGCCAGCATCTTGATTTTGG + Intergenic
1051600620 9:18869218-18869240 CCTTGCCAGCACTTTCATCTCGG + Intronic
1052084335 9:24246087-24246109 CCTTACCACCATCTTTTTCTAGG - Intergenic
1052348221 9:27431370-27431392 CCCTGTCTCCATTTTTTTCGTGG - Intronic
1057005697 9:91556559-91556581 AGCTGCGAGCCTTTTTTTCTTGG - Intergenic
1057057460 9:91974632-91974654 CCCTGCCAACACCTTTATCTTGG + Intergenic
1057282865 9:93725537-93725559 CCACGCCAGCACTGTTTTCTGGG - Intergenic
1057510349 9:95673937-95673959 ACCTGCCAGCATCTTGATCTTGG - Intergenic
1057589717 9:96361837-96361859 CCCTGCCAGCACTTTGGTCCTGG + Intronic
1059051904 9:110935491-110935513 CCCAGCCAATATTTTTTTCTAGG - Intronic
1059100195 9:111464129-111464151 CCCTGGGAGAGTTTTTTTCTAGG - Intronic
1059247469 9:112861077-112861099 CCCAGCAAGCCTTTGTTTCTGGG - Intronic
1059319337 9:113455965-113455987 GCCCCCCAGCATTTTATTCTGGG + Intronic
1059772419 9:117440094-117440116 TCCTGCCAGTATTTTTCCCTTGG - Intergenic
1059775522 9:117470863-117470885 CCCAACCAGCATTTTTTTATTGG + Intergenic
1062037711 9:134390112-134390134 CCCCGGCAGGATTTTTCTCTCGG + Intronic
1185758451 X:2671161-2671183 TACTGTCAGCATTTTTTTGTTGG - Intergenic
1186224894 X:7388158-7388180 CCCTTCCAGCCCTTTGTTCTTGG + Intergenic
1186435575 X:9540234-9540256 CCATGCCTGCATCTTTGTCTTGG - Intronic
1187417100 X:19102835-19102857 CCATGCCAGCATCTTGATCTTGG + Intronic
1187911534 X:24115711-24115733 CCCAGCCAGTATATTTTTTTAGG + Intergenic
1189259957 X:39671245-39671267 CCCTGCCAGCATTTTCATCTTGG + Intergenic
1189605612 X:42674568-42674590 CCCTACCAGCATCTTGATCTTGG - Intergenic
1189717105 X:43878243-43878265 CCCTCCCAGTCTTTTTTTATAGG + Intronic
1189824895 X:44908123-44908145 TCCTGCCATCATTTCTTTCCAGG + Intronic
1190325477 X:49204666-49204688 CCCTGGCAGGATTCTTCTCTGGG + Intergenic
1191603840 X:63040544-63040566 ATCTGCCAGTATGTTTTTCTTGG + Intergenic
1194758294 X:97763660-97763682 CCCTGTGTGCATTTGTTTCTGGG + Intergenic
1195430159 X:104780123-104780145 CCCTACCTGAATTTGTTTCTTGG - Intronic
1195621805 X:106963781-106963803 CTCAGCTTGCATTTTTTTCTGGG - Intronic
1195636894 X:107127756-107127778 CACTGCCTCAATTTTTTTCTGGG - Intronic
1196815742 X:119664352-119664374 TCCTCCCAGTCTTTTTTTCTAGG - Intronic
1197013076 X:121590695-121590717 ATCTGCCAGCATTCTTTCCTTGG - Intergenic
1197867351 X:131033528-131033550 CCCTGCCAGCACCTTGATCTTGG - Intergenic
1197943512 X:131814006-131814028 GCTTTGCAGCATTTTTTTCTAGG + Intergenic
1198780642 X:140231954-140231976 ACCTGCCAGCATCTTGATCTTGG - Intergenic
1199326129 X:146500860-146500882 CCATGCCAGAATTATTCTCTTGG - Intergenic
1199556609 X:149115952-149115974 CCTTGCCAGCATCTGTTTGTTGG - Intergenic
1201902317 Y:19056288-19056310 TTCTGCCAGCATCTATTTCTGGG - Intergenic