ID: 1134247002

View in Genome Browser
Species Human (GRCh38)
Location 16:12547546-12547568
Sequence GGGGATGTTAACCACAGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134247002_1134247003 -10 Left 1134247002 16:12547546-12547568 CCTGAGCTGTGGTTAACATCCCC No data
Right 1134247003 16:12547559-12547581 TAACATCCCCCTCCCTCACGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134247002 Original CRISPR GGGGATGTTAACCACAGCTC AGG (reversed) Intronic
No off target data available for this crispr