ID: 1134247652

View in Genome Browser
Species Human (GRCh38)
Location 16:12551978-12552000
Sequence CAGCAGGAGCTACTTTGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134247652_1134247658 10 Left 1134247652 16:12551978-12552000 CCATGTCAAAGTAGCTCCTGCTG No data
Right 1134247658 16:12552011-12552033 CTAAAAAACGTGGCAAGTCCAGG No data
1134247652_1134247661 24 Left 1134247652 16:12551978-12552000 CCATGTCAAAGTAGCTCCTGCTG No data
Right 1134247661 16:12552025-12552047 AAGTCCAGGCTCAGATGGGAAGG No data
1134247652_1134247659 19 Left 1134247652 16:12551978-12552000 CCATGTCAAAGTAGCTCCTGCTG No data
Right 1134247659 16:12552020-12552042 GTGGCAAGTCCAGGCTCAGATGG 0: 1
1: 0
2: 1
3: 22
4: 204
1134247652_1134247660 20 Left 1134247652 16:12551978-12552000 CCATGTCAAAGTAGCTCCTGCTG No data
Right 1134247660 16:12552021-12552043 TGGCAAGTCCAGGCTCAGATGGG No data
1134247652_1134247655 0 Left 1134247652 16:12551978-12552000 CCATGTCAAAGTAGCTCCTGCTG No data
Right 1134247655 16:12552001-12552023 GTCCCTGTCTCTAAAAAACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134247652 Original CRISPR CAGCAGGAGCTACTTTGACA TGG (reversed) Intronic
No off target data available for this crispr