ID: 1134247656

View in Genome Browser
Species Human (GRCh38)
Location 16:12552003-12552025
Sequence TGCCACGTTTTTTAGAGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 860
Summary {0: 1, 1: 1, 2: 5, 3: 68, 4: 785}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134247656_1134247659 -6 Left 1134247656 16:12552003-12552025 CCCTGTCTCTAAAAAACGTGGCA 0: 1
1: 1
2: 5
3: 68
4: 785
Right 1134247659 16:12552020-12552042 GTGGCAAGTCCAGGCTCAGATGG 0: 1
1: 0
2: 1
3: 22
4: 204
1134247656_1134247661 -1 Left 1134247656 16:12552003-12552025 CCCTGTCTCTAAAAAACGTGGCA 0: 1
1: 1
2: 5
3: 68
4: 785
Right 1134247661 16:12552025-12552047 AAGTCCAGGCTCAGATGGGAAGG No data
1134247656_1134247665 9 Left 1134247656 16:12552003-12552025 CCCTGTCTCTAAAAAACGTGGCA 0: 1
1: 1
2: 5
3: 68
4: 785
Right 1134247665 16:12552035-12552057 TCAGATGGGAAGGATTTTTGGGG 0: 1
1: 0
2: 2
3: 20
4: 257
1134247656_1134247663 7 Left 1134247656 16:12552003-12552025 CCCTGTCTCTAAAAAACGTGGCA 0: 1
1: 1
2: 5
3: 68
4: 785
Right 1134247663 16:12552033-12552055 GCTCAGATGGGAAGGATTTTTGG No data
1134247656_1134247664 8 Left 1134247656 16:12552003-12552025 CCCTGTCTCTAAAAAACGTGGCA 0: 1
1: 1
2: 5
3: 68
4: 785
Right 1134247664 16:12552034-12552056 CTCAGATGGGAAGGATTTTTGGG No data
1134247656_1134247660 -5 Left 1134247656 16:12552003-12552025 CCCTGTCTCTAAAAAACGTGGCA 0: 1
1: 1
2: 5
3: 68
4: 785
Right 1134247660 16:12552021-12552043 TGGCAAGTCCAGGCTCAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134247656 Original CRISPR TGCCACGTTTTTTAGAGACA GGG (reversed) Intronic
900239506 1:1608549-1608571 TGGTACATTTTGTAGAGACAGGG - Intergenic
900773361 1:4563305-4563327 AGCCTATTTTTTTAGAGACAGGG + Intergenic
901397343 1:8990991-8991013 TACCATTTTTTGTAGAGACAGGG - Intergenic
901474876 1:9482705-9482727 TACCACATTTTATAGATACAAGG + Intergenic
902200654 1:14831030-14831052 TCCCACTTTTAGTAGAGACAGGG + Intronic
902469893 1:16642015-16642037 TCCTTCTTTTTTTAGAGACAGGG + Intergenic
902636846 1:17740277-17740299 TCTCTCTTTTTTTAGAGACAGGG + Intergenic
902877782 1:19351312-19351334 TATTATGTTTTTTAGAGACAGGG + Intronic
903167292 1:21529777-21529799 TGTTTCGTTTTTTTGAGACAGGG + Intronic
903199452 1:21722364-21722386 TTACACTTTTTGTAGAGACAGGG - Intronic
903271912 1:22194303-22194325 TGCCTTTTTTTTTTGAGACAGGG + Intergenic
903470552 1:23584084-23584106 TGCCTATTTTTTTAGAGACAAGG - Intronic
903596703 1:24501035-24501057 TTCTACTTTTTGTAGAGACAAGG - Intergenic
903758151 1:25677613-25677635 GCCCATGTTTCTTAGAGACATGG + Intronic
903890008 1:26563231-26563253 TCCCCCTTTTTTTTGAGACAGGG + Intronic
903921976 1:26806164-26806186 TGCCATATTTTATAGAGATAAGG + Intergenic
903988643 1:27248828-27248850 TTTAACTTTTTTTAGAGACAGGG + Intronic
904004085 1:27354468-27354490 AAACACCTTTTTTAGAGACAAGG - Intergenic
904080323 1:27868503-27868525 TTAAATGTTTTTTAGAGACAGGG - Intergenic
904210133 1:28881840-28881862 TTCATCTTTTTTTAGAGACAGGG + Intergenic
905162742 1:36050997-36051019 TGACATTTTTTGTAGAGACAAGG + Intronic
905195766 1:36276010-36276032 TCCAACTTTATTTAGAGACAGGG - Intronic
905674366 1:39815428-39815450 TTGCTCATTTTTTAGAGACAAGG + Intergenic
905759522 1:40543008-40543030 TGACTTTTTTTTTAGAGACAGGG + Intronic
906031890 1:42727864-42727886 TTCTACTTTTTTTTGAGACAAGG - Intergenic
906271527 1:44483101-44483123 TTCTATGTTTTGTAGAGACAGGG + Intronic
906324324 1:44835075-44835097 TGTCTCTTTTTTTTGAGACAGGG + Intronic
906412677 1:45591825-45591847 TGTTTCATTTTTTAGAGACAGGG + Intronic
906870483 1:49474411-49474433 TTACACATTTTTTTGAGACAGGG + Intronic
906950445 1:50330976-50330998 TGCCATGTTTTTTATAGAGTGGG - Intergenic
908140981 1:61184364-61184386 TAGCAAGTTTTTTAGAAACAAGG - Intronic
908191472 1:61708071-61708093 TTTTAAGTTTTTTAGAGACAGGG + Intronic
908194663 1:61737132-61737154 TTCCATTTTTTGTAGAGACAGGG + Intergenic
908413905 1:63893657-63893679 TGCTTCGTTTCTTAGAAACACGG - Intronic
908597650 1:65705775-65705797 TGACACGCTTTTTAAAGATAAGG + Intergenic
909175690 1:72355187-72355209 TTCTTTGTTTTTTAGAGACAGGG - Intergenic
909266798 1:73570156-73570178 AGCTAATTTTTTTAGAGACAGGG - Intergenic
909573525 1:77146487-77146509 TTACATTTTTTTTAGAGACAGGG - Intronic
909630290 1:77763508-77763530 TGCAATTTTTTGTAGAGACAGGG - Intergenic
911008203 1:93250204-93250226 TTTCACTTTTTGTAGAGACAGGG - Intronic
911366347 1:96943190-96943212 TTCTTCTTTTTTTAGAGACAGGG - Intergenic
911909921 1:103620382-103620404 TGTTTTGTTTTTTAGAGACAGGG - Intronic
911913020 1:103659267-103659289 TGCTTTGTTCTTTAGAGACAGGG - Intronic
911915435 1:103692681-103692703 TGCTTTGTTCTTTAGAGACAGGG + Intronic
911917343 1:103714586-103714608 TGTTTTGTTTTTTAGAGACAGGG - Intronic
911920432 1:103753406-103753428 TGCTTTGTTCTTTAGAGACAGGG - Intronic
912299625 1:108501655-108501677 AGCCAACTTTTTTTGAGACAGGG + Intergenic
912374908 1:109202091-109202113 ATACATGTTTTTTAGAGACAGGG - Intronic
913142015 1:115950800-115950822 TGTCACTTTTTTTTGAGACAGGG - Intergenic
914703454 1:150153192-150153214 TGTTTTGTTTTTTAGAGACAGGG + Intronic
914863892 1:151409379-151409401 CGCCCCCTTTTTTTGAGACAGGG + Intronic
915186777 1:154112681-154112703 TTAAACTTTTTTTAGAGACAGGG - Intronic
915191131 1:154151779-154151801 TTTCTCTTTTTTTAGAGACAGGG - Intronic
915761049 1:158313481-158313503 TTGTACTTTTTTTAGAGACAAGG + Intergenic
916046616 1:161004708-161004730 TCTTATGTTTTTTAGAGACAGGG - Intronic
916550314 1:165843731-165843753 TCTCCTGTTTTTTAGAGACAGGG - Intronic
916646482 1:166791118-166791140 TGGAACGTTTCCTAGAGACACGG - Intergenic
916985403 1:170185906-170185928 TGACATTTTTTTTTGAGACAGGG + Intergenic
917230673 1:172834229-172834251 TGGCAGTTTTTTCAGAGACAGGG - Intergenic
917304373 1:173612069-173612091 TTCTACATTTTGTAGAGACAGGG - Intronic
917348420 1:174052895-174052917 TGCCAAGATTGTTATAGACATGG + Intergenic
917911710 1:179654590-179654612 TGGTACATTTTGTAGAGACAAGG - Intronic
917983089 1:180285343-180285365 TTTCACTTTTTTTTGAGACAAGG - Intronic
918023120 1:180714575-180714597 TTCCATTTTTTGTAGAGACAGGG + Intronic
918488653 1:185056363-185056385 TCTCATTTTTTTTAGAGACAGGG + Intronic
919240587 1:194911318-194911340 TGCCACATTTCTTATATACAAGG + Intergenic
919631131 1:199960872-199960894 TGCAACTTTTTGTAGAGATAGGG + Intergenic
919729622 1:200904737-200904759 TTCCAATCTTTTTAGAGACAGGG + Intronic
920493352 1:206436524-206436546 TAAAACATTTTTTAGAGACAGGG + Intronic
921123050 1:212153263-212153285 ACCCCCCTTTTTTAGAGACAGGG - Intergenic
921139453 1:212292577-212292599 TTCCATATTTTTTTGAGACAGGG + Intronic
921240814 1:213179406-213179428 TTCCTCTTTTTTTTGAGACAGGG - Intronic
921301644 1:213756622-213756644 TTCCACTTTTTTTTGAGACAGGG + Intergenic
922246536 1:223804110-223804132 TGTCTGGTTTTTTTGAGACAGGG - Intronic
922305868 1:224344016-224344038 TCAAACGTTTTTTTGAGACAAGG - Intergenic
922469455 1:225866913-225866935 TGCCAGGGTTTTAAGAAACACGG - Intronic
922519891 1:226240689-226240711 TGTTTTGTTTTTTAGAGACAGGG + Intronic
922923451 1:229328306-229328328 TGTTTCATTTTTTAGAGACAGGG + Intronic
923475288 1:234325926-234325948 TTCCTCTTTTTTTTGAGACAGGG - Intergenic
923706568 1:236349051-236349073 TTCCTTTTTTTTTAGAGACAGGG + Intronic
924280183 1:242429417-242429439 TAATACTTTTTTTAGAGACAAGG + Intronic
924495054 1:244580041-244580063 AGGCACATTTTTTTGAGACAGGG + Intronic
924600737 1:245486841-245486863 TTCCACTTTTTGCAGAGACAGGG + Intronic
924611310 1:245576009-245576031 TGCAAAGGTTTTTAGAGTCAGGG + Intronic
1062992956 10:1836965-1836987 TGCCATGAATTTTAGAGACCAGG + Intergenic
1063145164 10:3289610-3289632 TGCTTTGTTTTTTAGAGACGGGG + Intergenic
1063710076 10:8468800-8468822 TTCTACTTTTTGTAGAGACAGGG - Intergenic
1063937310 10:11091516-11091538 TTCCTCATTTTTTAAAGACAGGG + Intronic
1064074012 10:12254567-12254589 AACAACTTTTTTTAGAGACAGGG - Intergenic
1064345462 10:14528748-14528770 TTCCACATTTTTTAGAGAAAGGG - Intronic
1064441121 10:15354487-15354509 CACCACTTTTTTTTGAGACAGGG - Intronic
1065159662 10:22906626-22906648 TCCCATTTTTTTTTGAGACAGGG - Intergenic
1065162812 10:22940656-22940678 TTTCACTTTTTGTAGAGACAGGG + Intronic
1065386120 10:25134826-25134848 TAACACATTTTTTTGAGACAGGG + Intergenic
1065620102 10:27572149-27572171 CTCCCCCTTTTTTAGAGACAGGG + Intergenic
1065627329 10:27644835-27644857 TAAAATGTTTTTTAGAGACAGGG + Intergenic
1065697460 10:28392859-28392881 TTATATGTTTTTTAGAGACAAGG - Intergenic
1065805617 10:29391170-29391192 GGCTACCTTTTGTAGAGACAGGG + Intergenic
1065882272 10:30047078-30047100 GGCCACCTTTTTTAGAGACAAGG - Intronic
1066223717 10:33360822-33360844 TGCGACTTTATTTGGAGACAGGG - Intergenic
1066361830 10:34738744-34738766 TGCCCTGTTTTTTTAAGACAGGG - Intronic
1066378393 10:34880269-34880291 TGTCTCTCTTTTTAGAGACAGGG + Intergenic
1066378949 10:34885128-34885150 TTCTATGTTTTATAGAGACATGG - Intergenic
1066579169 10:36861271-36861293 TTGCACTTTTTGTAGAGACAGGG - Intergenic
1067116815 10:43441563-43441585 GGCCAATTTTTGTAGAGACAGGG + Intronic
1067908054 10:50314912-50314934 TGCTTTCTTTTTTAGAGACAGGG - Intronic
1068670045 10:59713298-59713320 TGTTTTGTTTTTTAGAGACATGG + Intronic
1069040319 10:63689200-63689222 TGCTAATTTTTGTAGAGACAGGG - Intergenic
1069046279 10:63746955-63746977 TCTCTCTTTTTTTAGAGACAGGG - Intergenic
1069404084 10:68079390-68079412 TGTTTTGTTTTTTAGAGACAGGG - Intergenic
1069477627 10:68748848-68748870 TGCACCTTTTTTTAGAGATAGGG + Intronic
1070038970 10:72756021-72756043 TTACATGTTTTGTAGAGACAAGG + Intronic
1070205092 10:74250785-74250807 TGCTTCATTTTTTTGAGACAGGG + Intronic
1070285545 10:75080840-75080862 TGTTTGGTTTTTTAGAGACAGGG + Intergenic
1070316520 10:75318494-75318516 TTCTATTTTTTTTAGAGACAGGG - Intergenic
1070621518 10:78015651-78015673 TACTTCTTTTTTTAGAGACAGGG + Intronic
1071854149 10:89606528-89606550 TTTCATGTTTTTTTGAGACAGGG + Intronic
1072470817 10:95711506-95711528 TTTCACTTTTTTTAGGGACAGGG + Intergenic
1072711973 10:97721756-97721778 TTCCTCTTTTTTTTGAGACAGGG + Intergenic
1072726920 10:97820009-97820031 TTCTACTTTTTGTAGAGACAGGG - Intergenic
1073244875 10:102082742-102082764 GGCCAGTTTTTGTAGAGACAGGG + Intergenic
1073537049 10:104287058-104287080 TGCCATTTTATTTTGAGACAGGG + Intronic
1075107057 10:119547066-119547088 TGTTTTGTTTTTTAGAGACAGGG + Intergenic
1075223471 10:120604022-120604044 TGCGACCTTATTTGGAGACAAGG + Intergenic
1075501444 10:122978880-122978902 CCCCACTTTTTTAAGAGACAGGG - Intronic
1075628767 10:123986515-123986537 TTCTACTTTTTATAGAGACAGGG + Intergenic
1076114998 10:127889147-127889169 TCTTACGTTTTGTAGAGACAGGG - Intronic
1077531584 11:3098973-3098995 TGGTACTTTTTGTAGAGACAGGG + Intronic
1077666110 11:4111155-4111177 TAAAACGTTTTGTAGAGACATGG - Intronic
1077688990 11:4322678-4322700 TGTTTTGTTTTTTAGAGACAAGG - Intergenic
1078126924 11:8575035-8575057 TTCCCCCTTTTTTTGAGACAGGG - Intronic
1079045435 11:17098250-17098272 TGCCACTGTATTTAGAGATAGGG + Intronic
1079750125 11:24185895-24185917 TGTCATTTTTTTAAGAGACATGG - Intergenic
1080523998 11:33095213-33095235 TTAAATGTTTTTTAGAGACAGGG + Intronic
1081579135 11:44339971-44339993 TCCCCCTTTTTTTTGAGACAGGG + Intergenic
1081801885 11:45865736-45865758 TGCCCCTTTTTTTTGAGACAGGG - Intronic
1081813426 11:45925856-45925878 TGTTTTGTTTTTTAGAGACAGGG - Intronic
1081854006 11:46292631-46292653 GATCCCGTTTTTTAGAGACAGGG + Intronic
1081922830 11:46794827-46794849 TTCTATATTTTTTAGAGACAAGG - Intronic
1082086547 11:48055011-48055033 TTGCATGTTTTATAGAGACAGGG - Intronic
1083425497 11:62582591-62582613 TTCTACTTTTTTTTGAGACAGGG - Intronic
1083974726 11:66108550-66108572 TGCCAGCTTTTGTAGAGACAGGG - Intronic
1084193766 11:67511683-67511705 GGCTACTTTTTGTAGAGACAGGG - Intergenic
1084756073 11:71239644-71239666 TGTCTTGTTTTCTAGAGACAGGG + Intronic
1085676122 11:78520490-78520512 TGCAACCTTTTTTAGAAACAGGG - Intronic
1086353182 11:85964404-85964426 TGCCAGGTTTTGTAGAAAGATGG + Intronic
1087053819 11:93911950-93911972 TTTCACTTTTTTTAGAGACAGGG - Intergenic
1087059771 11:93966087-93966109 TGCATCCTTTTTTTGAGACAGGG - Intergenic
1087932414 11:103993247-103993269 TTTCACTTTTTGTAGAGACAGGG + Intronic
1088177907 11:107074523-107074545 TTCTACTTTTATTAGAGACAGGG - Intergenic
1088463440 11:110107833-110107855 TTCCATTTTTTGTAGAGACAAGG + Intronic
1089539403 11:119181032-119181054 TTCCCCTTTTTTGAGAGACAGGG - Intronic
1089596167 11:119581954-119581976 TTACTTGTTTTTTAGAGACAGGG - Intergenic
1089931150 11:122313876-122313898 AGCTAAGTTTTGTAGAGACAGGG - Intergenic
1090342457 11:126036859-126036881 TTCCACTTTTTGTAGAGACAGGG + Intronic
1090469638 11:126968912-126968934 TGCCCCGTTTTTTACAGATGAGG - Intronic
1091481688 12:838993-839015 TGGTAAGTTCTTTAGAGACAGGG - Intronic
1091516177 12:1184757-1184779 TTCTTTGTTTTTTAGAGACAGGG + Intronic
1091927681 12:4369267-4369289 TGCCACTTCATTTAGAGAAAAGG + Exonic
1092180973 12:6446615-6446637 AGCCAATTTTTTTAGAGACAAGG - Intronic
1092185165 12:6473426-6473448 AACCCCGTTTTTTTGAGACAGGG - Intergenic
1092473531 12:8799289-8799311 CGCCACCATTTTTTGAGACAGGG + Intergenic
1092577709 12:9806686-9806708 TTCTATTTTTTTTAGAGACAGGG + Intergenic
1093452494 12:19332265-19332287 TGCAGAGTTTTCTAGAGACAGGG - Intronic
1095419232 12:42007953-42007975 AACCACACTTTTTAGAGACAGGG - Intergenic
1095735129 12:45547963-45547985 TGCCACGTATTATGTAGACATGG - Intergenic
1095750841 12:45709052-45709074 TTTTACATTTTTTAGAGACAGGG - Intergenic
1095796606 12:46225879-46225901 TGCCACTTATTTAAGAAACAGGG - Intronic
1095852174 12:46822604-46822626 TTCCACGTGTCTTGGAGACAGGG - Intronic
1096306842 12:50485181-50485203 TGGCTAATTTTTTAGAGACAGGG - Intergenic
1096379125 12:51140597-51140619 TCCTTCATTTTTTAGAGACAGGG + Intronic
1096406749 12:51349378-51349400 TTTCATGTTTTGTAGAGACAAGG - Intergenic
1096438830 12:51620978-51621000 CCCCACGTTTTTTTGAGACAGGG - Intronic
1096830240 12:54308126-54308148 GGCCAATTTTTGTAGAGACAGGG + Intronic
1096986861 12:55765350-55765372 GCCCACGTTTTTTAGAGACAGGG + Intronic
1097109498 12:56647687-56647709 TTACATATTTTTTAGAGACAAGG - Intergenic
1097843969 12:64347581-64347603 TTCCCTGTTTTCTAGAGACAGGG + Intronic
1098665788 12:73161610-73161632 TGCCACCTTTTTTGGAAATAGGG + Intergenic
1099128737 12:78799664-78799686 TGCCCTGATTTTTAGAGCCAGGG + Intergenic
1099169095 12:79342236-79342258 TGTTTTGTTTTTTAGAGACAGGG + Intronic
1099192845 12:79578177-79578199 TATCACTGTTTTTAGAGACAGGG - Intronic
1099201413 12:79681443-79681465 TTGTATGTTTTTTAGAGACAGGG - Intronic
1099217683 12:79873655-79873677 CACCACTTTTTTTGGAGACAGGG - Intronic
1100214645 12:92434961-92434983 TTCCTCTTTCTTTAGAGACAGGG + Intergenic
1100856314 12:98760436-98760458 TTGTATGTTTTTTAGAGACAGGG + Intronic
1102104581 12:110310296-110310318 TGGGATGTTTTTTTGAGACAAGG + Intronic
1102862208 12:116345701-116345723 CTCAACGTTTTTTAAAGACATGG - Intergenic
1103051308 12:117782268-117782290 TAACAGGTTTTTTTGAGACAGGG + Intronic
1103218460 12:119222862-119222884 TTTCATTTTTTTTAGAGACAAGG + Intergenic
1103280868 12:119756954-119756976 AGCCAATTTTTGTAGAGACAGGG - Intronic
1103310399 12:120002253-120002275 TGTGACCTTATTTAGAGACAGGG - Intronic
1103510769 12:121472114-121472136 TGTTACTTTTTTTTGAGACAGGG - Intronic
1103818074 12:123674876-123674898 TTTCATTTTTTTTAGAGACACGG + Intronic
1103837590 12:123835629-123835651 TCTCTCATTTTTTAGAGACAGGG + Intronic
1104353127 12:128062063-128062085 TGCTCTGTTTTTTTGAGACACGG + Intergenic
1104551280 12:129759910-129759932 TGCCTTTTTTTTTTGAGACAGGG + Intronic
1105066877 12:133208646-133208668 TGCTTTGTTTTTTACAGACAGGG - Intergenic
1105211004 13:18256932-18256954 TTGTATGTTTTTTAGAGACAGGG - Intergenic
1105269400 13:18857175-18857197 GGCCGAGTTTTGTAGAGACAGGG - Intergenic
1105579975 13:21686445-21686467 AGCTACGTTTTTTAAAGAAAAGG - Intronic
1106526637 13:30546488-30546510 TTCCTCTTTTTTTAGAGACTGGG + Intronic
1107186190 13:37524115-37524137 TGTTCAGTTTTTTAGAGACAGGG + Intergenic
1107677507 13:42812116-42812138 TTCCAGTGTTTTTAGAGACAGGG + Intergenic
1108032257 13:46244761-46244783 TCCCCCTTTTTTTAGAGACAAGG - Intronic
1109281554 13:60362490-60362512 TGCAATATTTTTTTGAGACAGGG - Intergenic
1109967298 13:69717193-69717215 TGCTATGTTTTGTAGAGAGATGG - Intronic
1110474666 13:75900060-75900082 AGGCACATTTTTTTGAGACAAGG - Intergenic
1110940429 13:81341816-81341838 TGCATTTTTTTTTAGAGACAGGG - Intergenic
1111871254 13:93835446-93835468 AGTCACGTTTTTTTGAGACAGGG - Intronic
1112115763 13:96351482-96351504 TTCTATGTTTTGTAGAGACAGGG + Intronic
1112513377 13:100030084-100030106 TGTTCTGTTTTTTAGAGACAAGG - Intergenic
1112590063 13:100754793-100754815 TTCCACTGTTTTTAGAGACGGGG - Intergenic
1112650503 13:101391508-101391530 TAAAACTTTTTTTAGAGACAGGG - Intronic
1112976171 13:105320802-105320824 TTCTTCTTTTTTTAGAGACAGGG - Intergenic
1112993636 13:105545196-105545218 TGTCTTGTTTCTTAGAGACAGGG - Intergenic
1114180458 14:20362694-20362716 TGTCTGGTTTTTTTGAGACAGGG - Intergenic
1114187940 14:20417336-20417358 TGGCATCTTTTATAGAGACAGGG - Intergenic
1114306693 14:21430097-21430119 TCCTACTTTTTTTAGAGACAAGG + Intronic
1114431175 14:22662594-22662616 TTTCTGGTTTTTTAGAGACAGGG + Intergenic
1114503196 14:23187353-23187375 TCCCCCCTTTTTTAGAGACAAGG + Intronic
1114624801 14:24122000-24122022 AGCCATTTTTTGTAGAGACAAGG - Intronic
1114744085 14:25128021-25128043 TGTGACATTTTTTAGAGATAAGG + Intergenic
1114862021 14:26535546-26535568 TGCCAGGGTTTTTTGAGAAAGGG - Intronic
1115330181 14:32188624-32188646 TTCTACTTTTTTTTGAGACACGG - Intergenic
1116375896 14:44200443-44200465 TGCATTATTTTTTAGAGACAGGG - Intergenic
1117014532 14:51505241-51505263 TTAAACTTTTTTTAGAGACAGGG + Intronic
1117361546 14:54980150-54980172 AGCTACTTTTTGTAGAGACAGGG - Intronic
1118187487 14:63550598-63550620 TGTTATTTTTTTTAGAGACAGGG - Intergenic
1118462091 14:65996645-65996667 TGTAACTTTTTTTAGAGACTCGG + Intronic
1118973923 14:70661306-70661328 TGTCACTTTATTTGGAGACAGGG - Intronic
1119206671 14:72799490-72799512 GGCCAATTTTTGTAGAGACAAGG - Intronic
1119227923 14:72958264-72958286 TCCCCCATTTTTTAGGGACAGGG - Intronic
1119309861 14:73636718-73636740 TGCTAATTTTTGTAGAGACAAGG - Intergenic
1119378999 14:74216979-74217001 CACCCCGTTTTTTAGAGACAGGG - Intergenic
1120436275 14:84487041-84487063 TTTAACGTTTTGTAGAGACAAGG - Intergenic
1120836013 14:89038968-89038990 TTTTACGTTTTGTAGAGACAAGG - Intergenic
1120991101 14:90378047-90378069 TGCTTGTTTTTTTAGAGACAGGG - Intergenic
1121111918 14:91318407-91318429 TGACTCGGTTTTTTGAGACAGGG - Intronic
1202901344 14_GL000194v1_random:42384-42406 AGACACGTTTTTTAGTGTCACGG + Intergenic
1123712885 15:23002991-23003013 TTCCCTTTTTTTTAGAGACAGGG - Intronic
1123775277 15:23573461-23573483 TTCCTATTTTTTTAGAGACAGGG - Intronic
1124925703 15:34068377-34068399 TTCTACTTTTTGTAGAGACAGGG + Intergenic
1125368522 15:38945205-38945227 TGCCACAATTATTAGAGACCAGG - Intergenic
1125820089 15:42622372-42622394 TCTCTCTTTTTTTAGAGACAGGG + Intronic
1125851831 15:42911427-42911449 TACCTCTTTTGTTAGAGACAAGG - Intronic
1126647167 15:50885941-50885963 ACCCAGGTTTTTTAGAGACGAGG - Intergenic
1126875870 15:53040380-53040402 TTTCTCTTTTTTTAGAGACAAGG - Intergenic
1127108519 15:55643594-55643616 TGGCATTTTTTGTAGAGACAAGG + Intronic
1127408590 15:58680981-58681003 TTTTATGTTTTTTAGAGACAAGG + Intronic
1128094122 15:64940743-64940765 AGACAGATTTTTTAGAGACAAGG + Intronic
1128525355 15:68408584-68408606 TGCCATGGTTGTTAGAGAGAAGG + Intronic
1128615822 15:69108683-69108705 TCCCACTTTTCTTAGAGACATGG + Intergenic
1128615920 15:69109670-69109692 AGCCAAGTTTTTTTGAGACTAGG - Intergenic
1129370078 15:75087510-75087532 TCCTATTTTTTTTAGAGACAGGG - Intronic
1131043625 15:89295972-89295994 TACTACTTTTTTTGGAGACAGGG + Intronic
1131140318 15:89971959-89971981 TTCCCCTTTTTTTTGAGACAGGG + Intergenic
1131196221 15:90357332-90357354 TGTAACTTTTTGTAGAGACAGGG - Intronic
1131958724 15:97765689-97765711 TGTCACCTTATTTAGAGACAGGG + Intergenic
1132059537 15:98680569-98680591 TGTTTCGTTTTTAAGAGACAGGG + Intronic
1132494862 16:257811-257833 TCCCCCTTATTTTAGAGACAGGG - Intronic
1133123391 16:3626876-3626898 TTTTATGTTTTTTAGAGACAGGG + Intronic
1133217486 16:4301895-4301917 GGCTAATTTTTTTAGAGACAGGG + Intergenic
1133280243 16:4660986-4661008 TTCCCCCTTTTTTTGAGACAGGG + Intronic
1133557067 16:6915722-6915744 TTCTACTTTTTGTAGAGACAGGG + Intronic
1133974952 16:10594100-10594122 TGCTACTATTTTTAGAGACAGGG + Intergenic
1134183754 16:12067174-12067196 TCCCGCTTTTTTTAGAGGCAGGG - Intronic
1134247656 16:12552003-12552025 TGCCACGTTTTTTAGAGACAGGG - Intronic
1134293282 16:12921587-12921609 TTTTACTTTTTTTAGAGACAGGG - Intronic
1134587163 16:15421745-15421767 TTCTACTTTTTGTAGAGACAGGG + Intronic
1134604790 16:15561884-15561906 TATTATGTTTTTTAGAGACAGGG - Intronic
1134673377 16:16072355-16072377 TGGTATGTTTTGTAGAGACAGGG + Intronic
1135011042 16:18879001-18879023 TGCAATTTTTTTTTGAGACAGGG - Intronic
1135292983 16:21256201-21256223 TTCCAACTTTTTTTGAGACAGGG + Intronic
1135315948 16:21444466-21444488 TTCTTCTTTTTTTAGAGACAGGG + Intronic
1135368873 16:21876728-21876750 TTCTTCTTTTTTTAGAGACAGGG + Intronic
1135403247 16:22180687-22180709 TTCATAGTTTTTTAGAGACAGGG - Intronic
1135442943 16:22494415-22494437 TTCTTCTTTTTTTAGAGACAGGG - Intronic
1135592641 16:23715248-23715270 TGTTTTGTTTTTTAGAGACAGGG - Intergenic
1135594943 16:23734707-23734729 TGCTTTGTTTTTTTGAGACAGGG + Intergenic
1135647575 16:24176404-24176426 TTCTTCTTTTTTTAGAGACATGG - Intronic
1135728083 16:24872548-24872570 TGCTATATTTTTTTGAGACAGGG + Intronic
1135923818 16:26674566-26674588 TTTTATGTTTTTTAGAGACAGGG - Intergenic
1136045961 16:27615133-27615155 TAGGACGTTTTTTAGAGACAGGG + Intronic
1136133378 16:28239080-28239102 TTTCACTTTTTTTAGAGACAGGG - Intergenic
1136147692 16:28325123-28325145 TGTTACTTTTTGTAGAGACAGGG + Intergenic
1136312624 16:29423208-29423230 TTCTTCTTTTTTTAGAGACAGGG + Intergenic
1136314704 16:29446309-29446331 TGCAATTTTTTTTTGAGACAGGG - Intronic
1136326058 16:29524950-29524972 TTCTTCTTTTTTTAGAGACAGGG + Intergenic
1136328146 16:29548045-29548067 TGCAATTTTTTTTTGAGACAGGG - Intergenic
1136440747 16:30264934-30264956 TTCTTCTTTTTTTAGAGACAGGG + Intergenic
1136442831 16:30288068-30288090 TGCAATTTTTTTTTGAGACAGGG - Intergenic
1137248872 16:46728712-46728734 TGAAACTTTTTTTAGAGACAAGG - Intronic
1138001282 16:53282431-53282453 TTCTACTTTTTGTAGAGACAGGG - Intronic
1138126973 16:54447130-54447152 TCCCACGTTTTTTAGAGACAAGG + Intergenic
1138452509 16:57102123-57102145 TGCCATTTTTTGTAGAGACAGGG + Intronic
1138559307 16:57791059-57791081 TTCCATTTTTTGTAGAGACAGGG - Intronic
1139600146 16:67981607-67981629 TGCATTTTTTTTTAGAGACAGGG + Intergenic
1139648593 16:68349886-68349908 TCCCATTTTTTTTAGAGACAAGG - Intronic
1139731695 16:68951310-68951332 TGCCTTTTTTTTTTGAGACAGGG - Intronic
1139762395 16:69196063-69196085 TTACATGTTTTGTAGAGACAGGG - Intronic
1139887261 16:70217253-70217275 TTCTTCTTTTTTTAGAGACAGGG + Intergenic
1139889574 16:70240542-70240564 TGCAATTTTTTTTTGAGACAGGG - Intergenic
1139894047 16:70274014-70274036 TGTTTCGTTTTTTTGAGACAGGG - Intronic
1140126308 16:72121629-72121651 TTCATCGTTTTTTAGAGACAGGG + Intronic
1140357719 16:74320423-74320445 TGTCTTGTTTTTTTGAGACAGGG - Intergenic
1141711224 16:85700257-85700279 TGTTTTGTTTTTTAGAGACAGGG - Intronic
1141711425 16:85701444-85701466 CTCCTCTTTTTTTAGAGACAGGG + Intronic
1142148560 16:88502813-88502835 TGCCACGTTTCTTCCAGAGAAGG + Intronic
1142496522 17:309284-309306 TGCTCCTTTTTTAAGAGACAAGG - Intronic
1142669623 17:1482051-1482073 TTCTATTTTTTTTAGAGACAGGG + Intronic
1143081896 17:4387997-4388019 TGAAATGTTTTGTAGAGACAGGG + Intergenic
1143206959 17:5149556-5149578 TTCTAATTTTTTTAGAGACAAGG - Intronic
1143817557 17:9529982-9530004 TGTTTTGTTTTTTAGAGACAGGG - Intronic
1143861791 17:9896727-9896749 AGCCCCTTGTTTTAGAGACAAGG - Exonic
1143900070 17:10167675-10167697 TGTGTCTTTTTTTAGAGACAGGG + Intronic
1144838091 17:18168206-18168228 TACCACTTTTTATAGAGACGGGG + Intronic
1144938551 17:18919657-18919679 TGCTATCTTTTTTAGAGACAGGG - Intronic
1145083711 17:19917474-19917496 TGTTTTGTTTTTTAGAGACATGG + Intronic
1145768075 17:27472916-27472938 TGCCCAGGTTTTTTGAGACAGGG + Intronic
1146021194 17:29280677-29280699 TGGCTCTTTTTTAAGAGACAGGG - Intronic
1146114961 17:30127419-30127441 TTGCACTTTTTTTGGAGACAAGG + Intronic
1146152058 17:30481955-30481977 TTCTATTTTTTTTAGAGACAGGG - Intronic
1146706221 17:35002503-35002525 TCATATGTTTTTTAGAGACAGGG + Intronic
1146862558 17:36317060-36317082 TTGCACTTTTTGTAGAGACAAGG + Intronic
1146899428 17:36572685-36572707 TTTCACGGTTTTTTGAGACAGGG - Intronic
1147092886 17:38121157-38121179 TTGCACTTTTTGTAGAGACAAGG + Intergenic
1147104322 17:38199331-38199353 TTGCACTTTTTGTAGAGACAAGG - Intergenic
1147136561 17:38437452-38437474 TGGCTAATTTTTTAGAGACAGGG - Intronic
1147354316 17:39881651-39881673 TGTTTTGTTTTTTAGAGACAGGG + Intergenic
1147397902 17:40159228-40159250 TGCAACTCTTTTTTGAGACAGGG - Intronic
1147786651 17:42983173-42983195 TGCCTTTTTTTTTTGAGACAGGG - Intronic
1147962057 17:44173805-44173827 TCCCACTTTTTTTTAAGACAGGG - Intronic
1148425171 17:47589086-47589108 TTGCACTTTTTGTAGAGACAAGG + Intronic
1148873219 17:50670880-50670902 TTCCATGTTTTTTAGAGTAAAGG - Intronic
1149674729 17:58449525-58449547 TTGCAGGTTTTGTAGAGACAGGG - Intronic
1149873394 17:60204322-60204344 TTCTAATTTTTTTAGAGACAAGG + Intronic
1150087180 17:62281572-62281594 TTCTAATTTTTTTAGAGACAAGG + Intronic
1150149419 17:62797007-62797029 TCCCTCTTTTTTTTGAGACATGG - Intronic
1150232794 17:63566905-63566927 TGCAACTTTTTTTTGAGACAAGG - Intronic
1150423739 17:65060011-65060033 TGTCTTGTTTTTTAGAGATAGGG - Intergenic
1150673205 17:67220487-67220509 TAACACTTTTTTTTGAGACAGGG + Intronic
1151250533 17:72830594-72830616 TGCCCTGTTGCTTAGAGACAGGG - Intronic
1151329040 17:73396058-73396080 TGCTAAGTTTTGTAGAGACGAGG + Intronic
1151366483 17:73620024-73620046 TTGTACGTTTTGTAGAGACAGGG - Intronic
1151528812 17:74690923-74690945 TTCCTCGTTTTTTTGAGACAGGG + Intronic
1151645713 17:75430012-75430034 TTCTACTTTTTGTAGAGACAGGG - Intergenic
1151920567 17:77151828-77151850 TGTTTTGTTTTTTAGAGACAGGG - Intronic
1152874152 17:82776400-82776422 TTCAACTTTTTTTTGAGACAGGG - Intronic
1152911802 17:83009532-83009554 TGCCACCGTCTTTAGAGCCAAGG - Intronic
1153042256 18:824300-824322 TTCCATTTTTTGTAGAGACAGGG - Intergenic
1153183784 18:2465051-2465073 TGGTTCTTTTTTTAGAGACAGGG - Intergenic
1153298755 18:3573872-3573894 TTCTACTTTTTGTAGAGACAAGG + Intronic
1153309982 18:3668317-3668339 TTCCATGTTTTCTAGAGACAGGG + Intronic
1153471564 18:5452035-5452057 TGACACTTTTAGTAGAGACATGG + Intronic
1153704548 18:7732508-7732530 TATTACTTTTTTTAGAGACAGGG + Intronic
1153857225 18:9161868-9161890 TATAACGTTTTTTAGAGACAGGG + Intronic
1155481323 18:26291265-26291287 TGTCTTGTTTTTTTGAGACAGGG + Intronic
1155620096 18:27768591-27768613 TTCTTCTTTTTTTAGAGACAGGG + Intergenic
1155690288 18:28613533-28613555 TTCCACGTTCTTTAGAACCATGG + Intergenic
1156340895 18:36209874-36209896 TGGCATTTTTTGTAGAGACAGGG + Intronic
1156342055 18:36218690-36218712 TTTCATTTTTTTTAGAGACAGGG + Intronic
1156603034 18:38632877-38632899 TGCCAAGTTGTTAAAAGACAAGG - Intergenic
1157351069 18:46886132-46886154 TGGAATGTGTTTTAGAGACATGG - Intronic
1158255690 18:55545849-55545871 AGACAGGTTTTTTAGAGACAGGG - Intronic
1158627133 18:59081252-59081274 TGTGACCTTTTTTAGAGATAGGG - Intergenic
1160232101 18:77056349-77056371 TGGCAAGTTTTCTAGAGACAAGG - Intronic
1160261931 18:77302160-77302182 TGCCATCTGTTTTTGAGACATGG + Intergenic
1160481890 18:79247661-79247683 TGACACGTAATTAAGAGACAAGG - Intronic
1160494534 18:79364849-79364871 TTCTATGTTTTGTAGAGACACGG - Intronic
1160657067 19:278753-278775 TACTTTGTTTTTTAGAGACAGGG - Intergenic
1160784970 19:896108-896130 TCTCATGTTTTGTAGAGACAAGG + Intergenic
1161244485 19:3241745-3241767 TGCCACCTTTGTCAGAAACACGG - Intronic
1161432969 19:4244730-4244752 TGGCAGTTTTTGTAGAGACAGGG - Intergenic
1161537636 19:4830092-4830114 TTTCATTTTTTTTAGAGACAGGG + Intronic
1162171489 19:8792868-8792890 TGTAATTTTTTTTAGAGACAAGG + Intergenic
1162710155 19:12587141-12587163 TACTTTGTTTTTTAGAGACAGGG + Intronic
1162761855 19:12893191-12893213 TGTTTCTTTTTTTAGAGACAGGG + Intronic
1162834323 19:13306381-13306403 TGCCTTTTTTTTAAGAGACAGGG + Intronic
1162862828 19:13520437-13520459 ACCCCCTTTTTTTAGAGACAAGG + Intronic
1162891528 19:13736723-13736745 TTCCATTTTTTTAAGAGACAGGG + Intronic
1163253271 19:16139572-16139594 TGCGATTCTTTTTAGAGACAAGG - Intronic
1163277392 19:16293929-16293951 TGTTAATTTTTTTAGAGACAAGG + Intergenic
1163349782 19:16769118-16769140 TGCCAGGTGTTCAAGAGACAGGG + Intronic
1163408654 19:17139730-17139752 TCCAATGTTTTTTTGAGACAGGG - Intronic
1163543732 19:17928194-17928216 TTCTACTTTTTGTAGAGACAGGG - Intergenic
1163543774 19:17928460-17928482 TTCTACTTTTTGTAGAGACAGGG - Intergenic
1163688820 19:18727241-18727263 TGCCTTGTTTGTTTGAGACAGGG - Intronic
1163824895 19:19517697-19517719 TTCTACTTTTTGTAGAGACAGGG + Intronic
1164125023 19:22305986-22306008 TGTTTTGTTTTTTAGAGACAGGG + Intronic
1164607087 19:29607262-29607284 TTCCAGTTTTTGTAGAGACAGGG - Intronic
1164962928 19:32451839-32451861 CCCCACTTTTTTTAGAGACCAGG + Intronic
1165352456 19:35283378-35283400 TGGTTTGTTTTTTAGAGACAGGG + Intronic
1165375730 19:35440379-35440401 TGCTATTTTTTGTAGAGACAGGG - Intergenic
1165919912 19:39289990-39290012 TTTCTCTTTTTTTAGAGACAGGG + Intergenic
1166574947 19:43828661-43828683 TTTAACTTTTTTTAGAGACAAGG + Intronic
1166604661 19:44130224-44130246 TTACACTTTTTGTAGAGACAAGG - Intronic
1166671580 19:44713117-44713139 TCTCTCTTTTTTTAGAGACAAGG - Intergenic
1167018484 19:46857289-46857311 TTGTACGTTTTGTAGAGACAGGG + Intergenic
1167109863 19:47453726-47453748 TGGTATGTTTTGTAGAGACAAGG - Intronic
1167330949 19:48855854-48855876 TTCTACTTTTTGTAGAGACAGGG - Intronic
1167753109 19:51392679-51392701 TGCCTTATTTTGTAGAGACAGGG + Intergenic
1168223102 19:54975292-54975314 TTTCACTTTTTGTAGAGACAGGG + Intronic
1168550361 19:57288207-57288229 TTCCCCTTTTTTAAGAGACAGGG + Intronic
925499994 2:4491841-4491863 TGCCATGTCTTTTAGTGAGAAGG + Intergenic
926654002 2:15379237-15379259 TTTCACTTTGTTTAGAGACAAGG - Intronic
927867814 2:26603041-26603063 CACCCCGTTTTTTAGAGACAGGG - Intronic
927903133 2:26837138-26837160 TACAACCTTTTTTCGAGACAGGG - Intergenic
928519917 2:32078641-32078663 TACTTCATTTTTTAGAGACAGGG - Intronic
928550787 2:32368364-32368386 TTCTACGTTTAGTAGAGACAAGG - Intronic
928638858 2:33276842-33276864 TGCTTTGTTTTTTGGAGACAAGG - Intronic
929169340 2:38915852-38915874 TTTCACTTTTTGTAGAGACAGGG - Intronic
929725073 2:44416938-44416960 TTTCACTTTTTTTAGAGACAGGG + Intronic
930120775 2:47758844-47758866 TTTCACTTTTTGTAGAGACAGGG - Intronic
930629774 2:53739844-53739866 TTCCATTTTTTGTAGAGACAAGG + Intronic
931338831 2:61378164-61378186 TCCCTCTTTTTTTTGAGACAGGG - Intronic
931427032 2:62180604-62180626 TGTTTTGTTTTTTAGAGACATGG + Intergenic
931567993 2:63636607-63636629 TTTCACTTTTTGTAGAGACAGGG + Intronic
932079639 2:68700290-68700312 TGACACTTTTTTTTGAGACAGGG - Intronic
933663693 2:84947466-84947488 TGTTTCGTTTTTTTGAGACAGGG - Intergenic
933754438 2:85626879-85626901 GGCTAAGTTTTGTAGAGACAGGG + Intronic
933866796 2:86526740-86526762 TGTCTTGTTTTATAGAGACAGGG + Intronic
934551253 2:95263653-95263675 AGCAACATTTTTTAGAGATATGG - Intergenic
935042971 2:99452250-99452272 TTCCATATTTTGTAGAGACAGGG - Intronic
935116044 2:100137393-100137415 TGCCATGGTATTTAGAAACAGGG + Intronic
935245486 2:101215659-101215681 TGAATTGTTTTTTAGAGACAGGG - Intronic
935273112 2:101451919-101451941 TTTCATGTTTTTTAGAGACGAGG - Intronic
935514175 2:104014989-104015011 TACCAGGTTTCTTAGGGACAGGG + Intergenic
935602199 2:104934066-104934088 TGTTAGCTTTTTTAGAGACAGGG - Intergenic
935765623 2:106364674-106364696 TCCTACATTTTTTAAAGACAAGG - Intergenic
935947352 2:108298378-108298400 TTGCACTTTTTTTTGAGACAGGG + Intronic
936044574 2:109176728-109176750 TGCCTTCTTTTTTAGAGACAGGG - Intronic
936139990 2:109931290-109931312 TTTTACTTTTTTTAGAGACAGGG + Intergenic
936176679 2:110229235-110229257 TTTTACTTTTTTTAGAGACAGGG + Intergenic
936204706 2:110440196-110440218 TTTTACTTTTTTTAGAGACAGGG - Intronic
936432908 2:112480525-112480547 CCCCACTTTTTTTTGAGACAGGG - Intergenic
936474582 2:112828935-112828957 GGGAACATTTTTTAGAGACAGGG + Intergenic
938461055 2:131496979-131497001 TTCCTTTTTTTTTAGAGACAAGG - Intergenic
939917108 2:148060112-148060134 TTGCACTTTTTGTAGAGACAGGG - Intronic
940224105 2:151383767-151383789 AGCTAATTTTTTTAGAGACAGGG - Intergenic
940647225 2:156404378-156404400 TTGTATGTTTTTTAGAGACATGG - Intergenic
941433670 2:165441505-165441527 TCCCACCTTTTTTAGAGACAGGG - Intergenic
941835166 2:170008472-170008494 AGTCAGGTTTTTTATAGACATGG + Intronic
941950327 2:171149196-171149218 TACCCTTTTTTTTAGAGACAGGG - Intronic
941982750 2:171477618-171477640 TTCTACTTTTTGTAGAGACAGGG - Intronic
942129531 2:172864729-172864751 TGGCATTTTTTGTAGAGACAGGG - Intronic
942191022 2:173470446-173470468 TGCTAATTTTTGTAGAGACAGGG + Intergenic
942288844 2:174449670-174449692 TGTTTAGTTTTTTAGAGACAGGG - Intronic
942341004 2:174946882-174946904 TTTTACATTTTTTAGAGACAGGG - Intronic
942611307 2:177745172-177745194 TGCCATGATTTTTTGTGACATGG - Intronic
945242899 2:207692930-207692952 TTACATTTTTTTTAGAGACAAGG + Intergenic
945272418 2:207954347-207954369 TGACAGGGTTTTTAGAGACAGGG - Intronic
945571367 2:211471967-211471989 TCCCCCTTTTTTAAGAGACAGGG - Intronic
945908095 2:215616355-215616377 TCCCCCCTTTTTTAGAGACAGGG - Intergenic
945951909 2:216047093-216047115 TGGCTAGTTTTGTAGAGACAGGG - Intronic
946179846 2:217942707-217942729 TGCCAGGGTCTTTGGAGACAAGG - Intronic
946390641 2:219414487-219414509 TGTTTTGTTTTTTAGAGACAGGG - Intergenic
946663553 2:222026770-222026792 TTTAACGTTTTGTAGAGACAGGG - Intergenic
946725023 2:222653792-222653814 AGCTACTTTTTGTAGAGACAGGG + Intronic
947024192 2:225718304-225718326 TGTTTTGTTTTTTAGAGACAGGG + Intergenic
947326714 2:228986971-228986993 TGCCAAGTCTTAAAGAGACAGGG + Intronic
948969116 2:241410600-241410622 TTGCACTTTTTTTAGAGACAGGG + Intronic
949010634 2:241676397-241676419 TGCCACATTTTTTGTAGAGACGG - Intronic
949042670 2:241856648-241856670 TTCCATTTTTTTTAGAGACAGGG - Intronic
1169086638 20:2830013-2830035 TGTTTTGTTTTTTAGAGACAGGG + Intergenic
1169212418 20:3774519-3774541 TCCCTTCTTTTTTAGAGACAGGG - Intergenic
1169383036 20:5125447-5125469 TTCTCCTTTTTTTAGAGACAGGG - Intronic
1169424854 20:5487899-5487921 TGCCAACTTTTTCAGATACAAGG - Intergenic
1169449357 20:5698163-5698185 TCTCTCTTTTTTTAGAGACACGG + Intergenic
1169513762 20:6294531-6294553 TCCCACTTTTCTTAGATACATGG - Intergenic
1169643406 20:7780321-7780343 TGCCACTTTTTTTACAGTTAAGG - Intergenic
1170155870 20:13268905-13268927 TGTGTCATTTTTTAGAGACAGGG - Intronic
1170414582 20:16126163-16126185 TGTTATTTTTTTTAGAGACAGGG - Intergenic
1170902032 20:20473487-20473509 TTCTACTTTTTTTTGAGACAGGG + Intronic
1170992413 20:21315496-21315518 TCCCCCTTTTTTTTGAGACAGGG + Intronic
1171029430 20:21663979-21664001 TCCCTCCTTTTTTCGAGACAGGG + Intergenic
1171099840 20:22372821-22372843 TGTCTTGTTTTTTTGAGACAGGG + Intergenic
1171251236 20:23650097-23650119 TTTCACTTTTTTTTGAGACAGGG + Intergenic
1172137911 20:32699988-32700010 TCCTATTTTTTTTAGAGACAAGG + Intergenic
1172140173 20:32717160-32717182 TGGTTTGTTTTTTAGAGACAGGG + Intronic
1172227723 20:33316389-33316411 TCCCCCTTTTTTTTGAGACAGGG - Intergenic
1172263183 20:33587114-33587136 TGGCATCTTTTTTAGAGACGAGG + Intronic
1172298594 20:33831888-33831910 TGCCCCATTTTTTAAGGACAAGG + Intronic
1172422677 20:34830643-34830665 TGCCTTTTTTTTTTGAGACAGGG - Intergenic
1172433294 20:34910645-34910667 TGATTTGTTTTTTAGAGACAGGG - Intronic
1172635500 20:36407166-36407188 TTTCACTTTTTGTAGAGACAGGG - Intronic
1172687794 20:36770069-36770091 GACAAAGTTTTTTAGAGACAGGG + Intronic
1172729422 20:37073126-37073148 TAAAATGTTTTTTAGAGACAGGG + Intronic
1173179514 20:40793910-40793932 AGCTATTTTTTTTAGAGACAGGG + Intergenic
1173380107 20:42532405-42532427 TTCCATCTTTTTTTGAGACAGGG + Intronic
1173670279 20:44794061-44794083 TGCCTTTATTTTTAGAGACAGGG - Intronic
1174227999 20:49020450-49020472 TTTCTCTTTTTTTAGAGACAGGG + Intronic
1174474112 20:50783789-50783811 TGTCATTTTTTGTAGAGACACGG + Intergenic
1174647833 20:52101376-52101398 TGCGATTTTTTTTTGAGACAAGG + Intronic
1174878527 20:54251880-54251902 TGCCCCATATTTTAGAAACAGGG + Intergenic
1174883297 20:54304249-54304271 ATCCACCTTTTTTTGAGACAGGG + Intergenic
1174945248 20:54977881-54977903 TTTTACGTTTTGTAGAGACAGGG - Intergenic
1176203371 20:63874544-63874566 TTTCACGTTTTATAGAGACAGGG + Intronic
1176367435 21:6041941-6041963 TCCATCTTTTTTTAGAGACAGGG - Intergenic
1176620719 21:9057162-9057184 AGACACGTTTTTTAGTGTCACGG + Intergenic
1176981978 21:15392667-15392689 TTTCACTTTTTGTAGAGACAGGG + Intergenic
1177638310 21:23814441-23814463 AGCCACGTTTTATAGAAAAAGGG - Intergenic
1177706759 21:24715641-24715663 TGGTATTTTTTTTAGAGACATGG - Intergenic
1178056608 21:28806478-28806500 TGCCACCTTATTTAGAAATAGGG + Intergenic
1178321200 21:31607171-31607193 TGCAACTTTTTTTTGAGACAGGG + Intergenic
1178746921 21:35260961-35260983 GGCTAATTTTTTTAGAGACATGG - Intronic
1178932366 21:36830666-36830688 TTAAACTTTTTTTAGAGACAAGG - Intronic
1179153265 21:38827765-38827787 TGCCACTTTTTTTTGAGACAGGG + Intergenic
1179215140 21:39361028-39361050 TGCTACTTTTTGTAGAGACAGGG - Intergenic
1179371601 21:40810896-40810918 TAGCATTTTTTTTAGAGACAGGG - Intronic
1179413687 21:41181155-41181177 TTCCAAGTTTTTTAGATACAAGG + Intronic
1179512184 21:41880265-41880287 AGCTAAGTTTTTTAGAGACAAGG - Intergenic
1179675534 21:42978904-42978926 GGCTATGTTTTTGAGAGACAGGG + Intronic
1179756083 21:43496605-43496627 TCCATCTTTTTTTAGAGACAGGG + Intergenic
1180236404 21:46462039-46462061 TAACACTTTTTTTTGAGACAAGG - Intronic
1180626519 22:17197440-17197462 TGTCCTGTTTTGTAGAGACAAGG + Intronic
1180966471 22:19790668-19790690 TGTAATGTTTTTTAAAGACAGGG - Intronic
1181650202 22:24254896-24254918 TTCTATTTTTTTTAGAGACACGG + Intergenic
1181656002 22:24299428-24299450 TTCACCGTTTTTTTGAGACAGGG - Intronic
1181707174 22:24655841-24655863 TTCTATTTTTTTTAGAGACACGG - Intergenic
1181832935 22:25577345-25577367 TTCTACTTTTTGTAGAGACAGGG + Intronic
1181954242 22:26576796-26576818 GGCCTTTTTTTTTAGAGACAGGG - Intronic
1182002407 22:26930829-26930851 TGTTTTGTTTTTTAGAGACAAGG + Intergenic
1182079707 22:27520256-27520278 TTCCACTTTTTATAGAGACAGGG - Intergenic
1182221516 22:28762437-28762459 TTGTACGTTTTGTAGAGACAGGG + Intergenic
1182353590 22:29712139-29712161 TTTCTCTTTTTTTAGAGACAGGG - Intergenic
1182366911 22:29785272-29785294 TGTCTTTTTTTTTAGAGACAGGG + Intergenic
1182388344 22:29967247-29967269 GCGCATGTTTTTTAGAGACAAGG + Intronic
1182570230 22:31231821-31231843 CCCCACCTTTTTTTGAGACAGGG + Intronic
1182836072 22:33342370-33342392 TGCCAGGTACTTAAGAGACATGG + Intronic
1183303426 22:37069660-37069682 TGCTACATTTTTTAGATACACGG - Intronic
1183496237 22:38145878-38145900 TTCTTTGTTTTTTAGAGACAAGG + Intronic
1183526146 22:38324084-38324106 TTCTTTGTTTTTTAGAGACAGGG + Intronic
1183926115 22:41207393-41207415 TTCCATTTTTTATAGAGACAGGG + Intronic
949567383 3:5257544-5257566 TGGTACTTTTTGTAGAGACAGGG + Intergenic
949927923 3:9056886-9056908 TGCCTTCTTTTTTTGAGACAGGG + Intronic
951001084 3:17560445-17560467 TTTCAATTTTTTTAGAGACAGGG - Intronic
951189413 3:19750585-19750607 TTCCATTTTTTTTTGAGACAGGG - Intergenic
951292788 3:20894070-20894092 TGCTTTGTTTTTTTGAGACAGGG + Intergenic
951508209 3:23472823-23472845 TGTTACTTTTTGTAGAGACAGGG + Intronic
951575994 3:24114700-24114722 TAGAACGTTTTGTAGAGACAGGG + Intergenic
953152350 3:40336118-40336140 TTTCTCTTTTTTTAGAGACAGGG - Intergenic
953156945 3:40384259-40384281 TGCTATTTTTTTTTGAGACAGGG + Intergenic
953731003 3:45448073-45448095 TCCTACTTTTTGTAGAGACAGGG - Intronic
954007350 3:47602283-47602305 TGGAACTTTTTTTTGAGACAGGG - Intronic
954023510 3:47763182-47763204 TTCAATCTTTTTTAGAGACAGGG + Intronic
954061030 3:48067500-48067522 TTACATGTTTTGTAGAGACAGGG + Intronic
954159461 3:48710383-48710405 TTTTACTTTTTTTAGAGACAGGG - Intronic
954242454 3:49304598-49304620 TTTCATTTTTTTTAGAGACAGGG + Intronic
954299540 3:49692239-49692261 TCCTTCTTTTTTTAGAGACAGGG - Intronic
954307303 3:49735353-49735375 CCCCACTCTTTTTAGAGACAAGG - Intronic
954560668 3:51553652-51553674 TAAAACGTTTTGTAGAGACAGGG - Intronic
955547993 3:60052118-60052140 TTCCAAGTTTTTTATATACAAGG - Intronic
956021439 3:64937658-64937680 CACTTCGTTTTTTAGAGACAGGG + Intergenic
956088336 3:65637378-65637400 TTACATTTTTTTTAGAGACAGGG - Intronic
956175159 3:66466036-66466058 TTTCATTTTTTTTAGAGACAGGG + Intronic
956401416 3:68883923-68883945 TGCCTTCTTTTTTTGAGACAGGG - Intronic
956764098 3:72469490-72469512 TTGTAAGTTTTTTAGAGACAGGG - Intergenic
956940259 3:74152276-74152298 TTGTACATTTTTTAGAGACAAGG + Intergenic
958498925 3:94880620-94880642 TTGCATGTTTTATAGAGACAGGG - Intergenic
958501416 3:94914582-94914604 TGCCACGCTTTCTAAATACAAGG - Intergenic
958540147 3:95460819-95460841 TTTCATTTTTTTTAGAGACAGGG + Intergenic
959056150 3:101569456-101569478 GGCTAAGTTTTGTAGAGACAGGG - Intergenic
960007217 3:112792578-112792600 TTTTATGTTTTTTAGAGACAAGG - Intronic
960114181 3:113877018-113877040 TTACTCTTTTTTTAGAGACAGGG + Intronic
960782624 3:121336486-121336508 TGGCTGGTTTTTTTGAGACAGGG - Intronic
960817954 3:121692823-121692845 TGTCACTTATTTTAGTGACATGG + Intronic
961887482 3:130105873-130105895 TGAAATTTTTTTTAGAGACAAGG - Intronic
962134667 3:132721773-132721795 TGTCTCTTTTTTTGGAGACAGGG - Exonic
962149472 3:132877791-132877813 TGTGACGATTATTAGAGACAAGG + Intergenic
962496248 3:135943171-135943193 TGCCTCTTTTTTTTAAGACAAGG + Intergenic
962820153 3:139040488-139040510 TGTTTTGTTTTTTAGAGACAGGG - Intronic
962957390 3:140278725-140278747 TGTTTTGTTTTTTAGAGACAGGG + Intronic
963164084 3:142183301-142183323 TGTTTTGTTTTTTAGAGACAGGG + Intronic
963664699 3:148167903-148167925 TGTTTTGTTTTTTAGAGACAGGG - Intergenic
965227637 3:166010157-166010179 TATTATGTTTTTTAGAGACAGGG + Intergenic
965868769 3:173239908-173239930 TAACATGTTTTTTAGGGACATGG - Intergenic
966127418 3:176596000-176596022 TTGCAGGTTTCTTAGAGACAGGG + Intergenic
966556011 3:181260984-181261006 TGGTACTTTTTGTAGAGACAGGG - Intergenic
967042246 3:185704454-185704476 TGTCTCTTTTTTTTGAGACACGG + Intronic
967066783 3:185924803-185924825 TGTCATCTTTTTTTGAGACAGGG - Intronic
967660252 3:192099025-192099047 TTTCATGTTTTGTAGAGACAGGG + Intergenic
967863886 3:194174687-194174709 TGCTCTTTTTTTTAGAGACAGGG - Intergenic
968014124 3:195312471-195312493 TGTAATTTTTTTTAGAGACAGGG + Intronic
968155512 3:196377842-196377864 TTCGACTTTTTGTAGAGACAGGG + Intronic
968209784 3:196839367-196839389 TATTAGGTTTTTTAGAGACAGGG - Intergenic
968330512 3:197865159-197865181 TTAGACGTTTTGTAGAGACAGGG + Intronic
968345060 3:197996773-197996795 TTTTATGTTTTTTAGAGACAGGG + Intronic
969073869 4:4561576-4561598 TTTCAACTTTTTTAGAGACAAGG + Intergenic
969252637 4:5979620-5979642 GTACATGTTTTTTAGAGACAGGG + Intronic
969874257 4:10124263-10124285 TGTGACCTTGTTTAGAGACAGGG - Intergenic
970420456 4:15901241-15901263 TTCTTCTTTTTTTAGAGACAGGG + Intergenic
970646519 4:18127763-18127785 AGCTAAGTTTTGTAGAGACAGGG - Intergenic
971163195 4:24155448-24155470 CGCTACGTTTTGTAGAGAAAGGG - Intergenic
971317231 4:25577619-25577641 TGTTTTGTTTTTTAGAGACAGGG + Intergenic
971373601 4:26038249-26038271 TAAAACTTTTTTTAGAGACAGGG - Intergenic
972373719 4:38450514-38450536 TGCCACGTGTCTTTGTGACATGG - Intergenic
973208086 4:47582968-47582990 TGTTATTTTTTTTAGAGACAGGG - Intronic
973242907 4:47977158-47977180 TGTGACGGTTTTTGGAGACAAGG + Intronic
973248641 4:48038472-48038494 TTTTACATTTTTTAGAGACATGG - Exonic
973306905 4:48662404-48662426 TGTTATTTTTTTTAGAGACAGGG - Intronic
973945544 4:55950610-55950632 TGTTACCTTTTTTAGAGACAGGG - Intronic
974931041 4:68361418-68361440 AGCAACTTTTTGTAGAGACAGGG - Intergenic
975571506 4:75822545-75822567 TGCTGCTTTTTTTTGAGACAGGG - Intergenic
975674943 4:76817592-76817614 TTCTACCTTTTGTAGAGACAGGG + Intergenic
975761748 4:77627027-77627049 CCCCACCTTTTTTTGAGACAGGG + Intergenic
976010161 4:80477056-80477078 TGCTTCTTTTTTTTGAGACAGGG + Intronic
976115465 4:81721728-81721750 TACTACTATTTTTAGAGACAAGG + Intronic
976248652 4:83028429-83028451 TTCAACTTTTTGTAGAGACAGGG - Intergenic
976277008 4:83288363-83288385 TGTCTAGTTTTTTTGAGACAGGG - Intergenic
976422863 4:84866062-84866084 TGGCACTTGTTTTTGAGACAGGG - Intronic
976680467 4:87750409-87750431 TGACTCTTTTTTTTGAGACAGGG + Intergenic
976718409 4:88147286-88147308 AGGTACGTTTTTTTGAGACAGGG - Intronic
977215019 4:94272232-94272254 TGCCATTGTATTTAGAGACAAGG - Intronic
977520706 4:98080263-98080285 TACCTTTTTTTTTAGAGACAGGG + Intronic
977912928 4:102558655-102558677 TTCCATTTTTTTAAGAGACAGGG + Intronic
978441223 4:108736097-108736119 TGTCTCCTTTTGTAGAGACAGGG + Intergenic
979671742 4:123366926-123366948 TGGCTTTTTTTTTAGAGACAGGG - Intergenic
980061156 4:128131539-128131561 CTTTACGTTTTTTAGAGACAGGG - Intronic
980445941 4:132907607-132907629 TTACAGTTTTTTTAGAGACAGGG - Intergenic
982364087 4:154556382-154556404 TGACAATTTTTTTCGAGACAGGG + Intergenic
983098517 4:163595508-163595530 TACCACATTTTTTGGAGACAGGG - Intronic
983295199 4:165858295-165858317 TGACACATCTTTTAAAGACAGGG - Intergenic
983588196 4:169378701-169378723 CCCCACCTTTTTTTGAGACAGGG + Intergenic
983621616 4:169767377-169767399 TACTACTTTTTATAGAGACAGGG - Intergenic
983653874 4:170060738-170060760 TTTCTCTTTTTTTAGAGACAGGG + Exonic
984116572 4:175688857-175688879 TGGTTTGTTTTTTAGAGACAGGG + Intronic
984351246 4:178596830-178596852 TGTCATTGTTTTTAGAGACAGGG - Intergenic
984942004 4:184941095-184941117 TGCCTCTTGTTTTTGAGACAGGG + Intergenic
984970970 4:185189820-185189842 TTCCACTTTTGATAGAGACACGG - Intronic
985550240 5:529001-529023 TATTATGTTTTTTAGAGACAGGG - Intergenic
985712985 5:1440579-1440601 TGTGACTTTATTTAGAGACAAGG + Intronic
985752713 5:1690788-1690810 TTCTATGTTTTGTAGAGACAGGG + Intergenic
986034588 5:3925586-3925608 TTCCATCTTTTTTAGAGACAGGG + Intergenic
986690814 5:10312347-10312369 TGTTTTGTTTTTTAGAGACAGGG + Intergenic
986835212 5:11629675-11629697 TTTTATGTTTTTTAGAGACATGG + Intronic
987357992 5:17081975-17081997 TGCTAATTTTTGTAGAGACAGGG - Intronic
987691297 5:21270042-21270064 TTTCACTTTTTATAGAGACAGGG + Intergenic
988137092 5:27187697-27187719 TCCCCCTTTTTTTTGAGACAGGG - Intergenic
988511297 5:31866862-31866884 TGTCATGTTTTTCAGAGTCAGGG + Intronic
988583257 5:32486807-32486829 TGTTTCGTTTTTTTGAGACAAGG + Intergenic
989056157 5:37368077-37368099 AGCCACTTTTTGTAGAGACAGGG + Intronic
989092706 5:37750525-37750547 TCACTCTTTTTTTAGAGACAGGG - Intronic
989553455 5:42763062-42763084 ACCAACGTTTTTTTGAGACATGG + Intronic
989605839 5:43243680-43243702 TGCTTTGTTTTTTTGAGACAGGG + Intronic
989789961 5:45386349-45386371 TTTCACTTTTTCTAGAGACAAGG + Intronic
990378779 5:55200976-55200998 TGTTTTGTTTTTTAGAGACAGGG - Intergenic
990436343 5:55795766-55795788 TGCCACGTTGTACTGAGACAGGG - Intronic
990650883 5:57898228-57898250 TTTCAATTTTTTTAGAGACAGGG + Intergenic
991081492 5:62605901-62605923 TTACATGTTTTGTAGAGACAGGG + Intronic
991963003 5:72064393-72064415 TTTCACTTTTTGTAGAGACAGGG + Intergenic
992205023 5:74422898-74422920 TGTCTGGTTTTTCAGAGACAAGG + Intergenic
992367137 5:76104378-76104400 AGCAACTTTTTTAAGAGACAAGG + Intronic
992396725 5:76375392-76375414 TGTTTTGTTTTTTAGAGACAGGG + Intergenic
992701009 5:79342028-79342050 TACCACTTTTTGCAGAGACAGGG - Intergenic
992785957 5:80170841-80170863 TGCTAATTTTTGTAGAGACAAGG - Intronic
992893051 5:81221676-81221698 GGCCACTTTTTGTAGAGACAGGG - Intronic
995414960 5:111899505-111899527 TTCTTCTTTTTTTAGAGACAGGG - Intronic
996721064 5:126630760-126630782 TGTCTTGTTTTTTGGAGACAAGG + Intergenic
996801548 5:127409068-127409090 TGATACTTTTTTTTGAGACAGGG - Intronic
997922140 5:137991926-137991948 AGCAACTTTTTTTTGAGACAGGG + Intronic
997949927 5:138234309-138234331 TTTCATGTTTTGTAGAGACAGGG + Intergenic
998054016 5:139058405-139058427 TGCAATGGTTTTTAGAGTCAAGG - Intronic
998575841 5:143315522-143315544 TTCCATCTTTTTTAGAGAAAAGG - Intronic
998948997 5:147372858-147372880 TACCACTTTTTTTAAACACATGG + Intronic
999216060 5:149936145-149936167 TCCTTCCTTTTTTAGAGACAGGG - Intronic
999781200 5:154851871-154851893 TGTTTTGTTTTTTAGAGACAGGG - Intronic
1000326264 5:160174940-160174962 TTCCATTTTTTATAGAGACAGGG + Intergenic
1000336155 5:160243067-160243089 TTGCATGTTTTGTAGAGACAGGG - Intergenic
1000612287 5:163387513-163387535 TGCCATTTTTCTTCGAGACAGGG - Intergenic
1001188723 5:169605074-169605096 CCCCACTTTTTTTTGAGACAGGG - Intergenic
1002325473 5:178402316-178402338 TGTCTCTGTTTTTAGAGACAGGG - Intronic
1002590644 5:180289860-180289882 TGCCTTCCTTTTTAGAGACAGGG + Intronic
1002950545 6:1806104-1806126 TGTTTCCTTTTTTAGAGACAGGG - Intronic
1003058876 6:2846988-2847010 TGCCAGGTGTTTTAGATACTGGG - Intergenic
1003101689 6:3180714-3180736 TTCCATTTTTTTAAGAGACAGGG - Intergenic
1003586342 6:7392534-7392556 TACAATTTTTTTTAGAGACAGGG + Intronic
1004175022 6:13332214-13332236 CGCCTCGTTTTCTAGAGATAAGG + Intergenic
1004546315 6:16601961-16601983 TCTCACGTATTTTAGAGTCAGGG + Intronic
1005174057 6:23024167-23024189 TTCTATTTTTTTTAGAGACAGGG + Intergenic
1005268647 6:24139914-24139936 TCCCACCTTTTTTAGAGACAGGG - Intronic
1005301742 6:24477721-24477743 TTTTACATTTTTTAGAGACAGGG - Intronic
1006086186 6:31597193-31597215 TATTACATTTTTTAGAGACAAGG + Intergenic
1006121989 6:31812826-31812848 TTTCTCATTTTTTAGAGACAGGG + Intronic
1006383496 6:33715275-33715297 TAACAATTTTTTTAGAGACAAGG - Intergenic
1006488655 6:34366562-34366584 TGTTTTGTTTTTTAGAGACAGGG + Intronic
1006535926 6:34698643-34698665 TTCAACTTTCTTTAGAGACAGGG + Intergenic
1006660256 6:35635442-35635464 TGCCTTTTTTTTTTGAGACAGGG - Intronic
1006895543 6:37466995-37467017 TTGTACGTTTTGTAGAGACAGGG - Intronic
1008644895 6:53504162-53504184 TTAAACCTTTTTTAGAGACAGGG - Intronic
1009436451 6:63623735-63623757 TGTTACTTTTTTTTGAGACACGG + Intergenic
1009542505 6:64980161-64980183 TGCCATTTTTTTTATAGAGAAGG - Intronic
1010370205 6:75098479-75098501 TTTCACTTTTTTTAGTGACAGGG - Intronic
1010750994 6:79615986-79616008 TTCTACTTTTTGTAGAGACAGGG + Intergenic
1010963910 6:82180423-82180445 TGCTATTTTTTGTAGAGACAGGG + Intronic
1012327316 6:97938018-97938040 TGCCAGGTTTTCTATATACAGGG + Intergenic
1012515578 6:100055211-100055233 CCCCACCTTTTTTTGAGACAGGG + Intergenic
1012658006 6:101850098-101850120 GGCTACGTTTTTGAGAAACAGGG - Intronic
1012938675 6:105394767-105394789 TGACTCTTTTGTTAGAGACAGGG - Intronic
1013043804 6:106463145-106463167 TGTTTTGTTTTTTAGAGACAGGG - Intergenic
1013492242 6:110660006-110660028 TGTTTTGTTTTTTAGAGACAGGG + Intronic
1014231931 6:118913604-118913626 TGTCCTGTTTTTTTGAGACAGGG + Intronic
1014448317 6:121554654-121554676 TGTTTGGTTTTTTAGAGACAAGG - Intergenic
1014758306 6:125326562-125326584 TGCCCCCTTTTTTTGAGGCATGG - Intergenic
1015049521 6:128822644-128822666 TTGCAATTTTTTTAGAGACAGGG - Intergenic
1015109602 6:129576452-129576474 TCTCAAATTTTTTAGAGACAGGG - Exonic
1015246128 6:131076779-131076801 TGCCTTTTTTTTAAGAGACAGGG + Intergenic
1015635261 6:135268392-135268414 TATTACTTTTTTTAGAGACAGGG + Intergenic
1015748716 6:136538603-136538625 TGTCTCTTTTTGTAGAGACAGGG - Intronic
1015847384 6:137535047-137535069 TTAAATGTTTTTTAGAGACAGGG + Intergenic
1015929318 6:138341407-138341429 TTCCACTTGTTTTACAGACAAGG + Exonic
1015998408 6:139018096-139018118 TAAAACATTTTTTAGAGACAGGG - Intergenic
1016818170 6:148323031-148323053 TTCCTCTTTTTTTTGAGACAGGG + Intronic
1017519960 6:155193395-155193417 TGACATTTTTTTTTGAGACAAGG - Intronic
1017735879 6:157362722-157362744 TGTTACTTTTTGTAGAGACAGGG - Intergenic
1017884448 6:158587437-158587459 TTCCATGTTTTTTAAAGCCAGGG - Intronic
1018212914 6:161499337-161499359 TCCCACTTTTGATAGAGACATGG - Intronic
1019716092 7:2540031-2540053 TTCCTTCTTTTTTAGAGACAGGG + Intronic
1020101810 7:5397999-5398021 TGTTTCTTTTTTTAGAGACAGGG + Intronic
1020214861 7:6182353-6182375 TGCTTCTTTTTTAAGAGACAGGG + Intronic
1020656385 7:10932795-10932817 TGTAATTTTTTTTAGAGACAGGG - Exonic
1020872029 7:13643374-13643396 TGCTACCATTTTTAGAGAAAAGG - Intergenic
1021013367 7:15500328-15500350 TTCCACTTTCTTTAAAGACAAGG - Intronic
1021505462 7:21379254-21379276 TTTTAAGTTTTTTAGAGACAAGG - Intergenic
1022720092 7:32934977-32934999 TTCCTCGTTTTTTAGAAAGAGGG - Intergenic
1023390957 7:39711260-39711282 TGTCTTTTTTTTTAGAGACAGGG + Intergenic
1025074835 7:55933876-55933898 TGCATCTTTTTGTAGAGACAGGG + Intronic
1026086687 7:67268672-67268694 GACAACCTTTTTTAGAGACAGGG - Intergenic
1026197042 7:68182071-68182093 TTGCATGTTTTGTAGAGACAGGG - Intergenic
1026333130 7:69370590-69370612 ATACACATTTTTTAGAGACAGGG - Intergenic
1026597902 7:71749897-71749919 TGTTTTGTTTTTTAGAGACAAGG + Intergenic
1026634147 7:72066617-72066639 TGACTCTTTTTTAAGAGACAGGG + Intronic
1026634994 7:72074412-72074434 TACCTTGTTTTTTTGAGACAGGG + Intronic
1026690450 7:72546164-72546186 GACAACATTTTTTAGAGACAGGG + Intergenic
1026912638 7:74100228-74100250 TGCCCCATTTTTTTGAGACAGGG - Intronic
1026980163 7:74521751-74521773 TACAACTTTTTTTAGAGATAGGG - Intronic
1027154128 7:75754480-75754502 TTCCCCGTTTTTTAGAGAGAGGG - Intergenic
1027196482 7:76034107-76034129 TGCTGCCTTTTTTTGAGACAAGG + Intronic
1027213392 7:76167665-76167687 TGTAATTTTTTTTAGAGACATGG - Intergenic
1027697600 7:81431484-81431506 TTCTATTTTTTTTAGAGACAGGG - Intergenic
1028750409 7:94376426-94376448 TTTCACTTTTTATAGAGACAGGG + Intergenic
1028919432 7:96294682-96294704 TGCTTTGTTTTTAAGAGACAGGG + Intronic
1029067465 7:97866105-97866127 AGACACGTTTTTTAGTGTCATGG - Intronic
1029258349 7:99284580-99284602 TGACACTTTTTTTTGAGACAGGG - Intergenic
1029422936 7:100480646-100480668 CGCCTTTTTTTTTAGAGACAGGG + Intergenic
1029473763 7:100770659-100770681 TTTCTTGTTTTTTAGAGACAAGG + Intronic
1029917410 7:104225469-104225491 TTACATTTTTTTTAGAGACAGGG + Intergenic
1030044929 7:105486396-105486418 TTCTTCCTTTTTTAGAGACAAGG + Intronic
1030084991 7:105808179-105808201 TGCCAGGTTACTTAGGGACAAGG + Intronic
1030195334 7:106847354-106847376 TGTAATTTTTTTTAGAGACAAGG - Intergenic
1030627381 7:111859023-111859045 TCCCCCCTTTTTTTGAGACAGGG + Intronic
1030849309 7:114463033-114463055 TATTATGTTTTTTAGAGACAGGG + Intronic
1031780809 7:125961726-125961748 TCCCATTTTTTTTAGAGAAATGG - Intergenic
1032350716 7:131160700-131160722 TGGCATTTTTTGTAGAGACAGGG + Intronic
1032393930 7:131575513-131575535 TGGCCCTTTTTTTAAAGACAGGG - Intergenic
1032424792 7:131813778-131813800 TTCCAGCTTTTTTTGAGACAGGG - Intergenic
1032670820 7:134080931-134080953 TTACAATTTTTTTAGAGACAGGG - Intergenic
1033163954 7:139022536-139022558 TCCGACGTTTTTTTGAGACAGGG - Intergenic
1033178085 7:139145586-139145608 AGCCAATTTTTGTAGAGACAGGG + Intronic
1033198959 7:139352020-139352042 TTACATTTTTTTTAGAGACAGGG - Intronic
1033395799 7:140972765-140972787 TGCAATTTTTTTTTGAGACAGGG + Intergenic
1033433261 7:141308403-141308425 TGTAATTTTTTTTAGAGACAGGG + Intronic
1034455964 7:151170372-151170394 TAAGACATTTTTTAGAGACAAGG - Intronic
1034675085 7:152887095-152887117 TTCAACATTTTTTTGAGACAGGG + Intergenic
1035735579 8:1884769-1884791 TTTCTTGTTTTTTAGAGACAGGG + Intronic
1036414232 8:8531842-8531864 TGTTTTGTTTTTTAGAGACAGGG + Intergenic
1036429952 8:8680965-8680987 TGCTTTGTTTTTTAGAGACAGGG + Intergenic
1036447631 8:8836383-8836405 TGTTTTGTTTTTTAGAGACAGGG + Intronic
1036674074 8:10814944-10814966 TTCTTCGTTTTTTTGAGACAGGG + Intronic
1036741919 8:11370956-11370978 AGCCAATTTTTGTAGAGACAGGG - Intergenic
1037765938 8:21772307-21772329 TGGGAGGTTTTTTTGAGACAGGG + Intronic
1038052120 8:23823848-23823870 TACCTCTTTTTTTAGAGACAGGG - Intergenic
1038636101 8:29288562-29288584 TGCCTTTTTTTTTTGAGACAGGG + Intergenic
1038806017 8:30792448-30792470 TTCCTCGTTTTTTTGAGACAAGG + Intronic
1038873463 8:31521475-31521497 TGACCAGTTTTTTAGAAACAGGG + Intergenic
1038970001 8:32622565-32622587 AGTAATGTTTTTTAGAGACAGGG + Intronic
1039798559 8:40935420-40935442 TGTCACTTTATTTAGAGATAGGG + Intergenic
1040674460 8:49732344-49732366 TCCTACTTTTTGTAGAGACAGGG + Intergenic
1040922438 8:52637376-52637398 TGACAATTTTTTAAGAGACAGGG + Intronic
1041047608 8:53902187-53902209 TGCTTCTTTTTGTAGAGACAGGG + Intronic
1041065646 8:54080212-54080234 GGCTACTTTTTGTAGAGACAGGG - Intronic
1041778763 8:61554742-61554764 ATACACATTTTTTAGAGACAGGG + Intronic
1042548888 8:69975541-69975563 TGCCCCATTTTTTAGAGATGGGG - Intergenic
1042579403 8:70260182-70260204 TGCTTTGTTTTTTTGAGACAGGG + Intronic
1043159208 8:76824744-76824766 TTTCATGTTTTGTAGAGACAGGG + Intronic
1044075361 8:87815309-87815331 TGGTACTTTTTGTAGAGACAGGG - Intergenic
1044421010 8:91995778-91995800 TTCCCCTTTTTTTTGAGACAGGG - Intronic
1044635634 8:94320929-94320951 TTTTATGTTTTTTAGAGACAGGG - Intergenic
1045277021 8:100716687-100716709 TGCAACTTTTTTAAGAGACAAGG + Intronic
1047502131 8:125450304-125450326 GGTCACTTTTTTTTGAGACAAGG + Intergenic
1048379587 8:133853488-133853510 TTTAACTTTTTTTAGAGACAGGG + Intergenic
1049142113 8:140964231-140964253 TGCCTGTTTTTTAAGAGACAGGG + Intronic
1049272218 8:141701815-141701837 TGCAACTTGTTTTAGACACATGG - Intergenic
1049837355 8:144745551-144745573 TTTTTCGTTTTTTAGAGACAGGG + Intronic
1050230050 9:3514466-3514488 TGCTTTGTTTTTTTGAGACAGGG + Intronic
1050279357 9:4034213-4034235 TACGACTTTTTTTTGAGACAAGG - Intronic
1050435735 9:5608305-5608327 TTAAATGTTTTTTAGAGACAGGG - Intergenic
1050460543 9:5873970-5873992 TCCTAACTTTTTTAGAGACAGGG - Intergenic
1051341600 9:16116887-16116909 TTTTACTTTTTTTAGAGACAGGG - Intergenic
1051504011 9:17808194-17808216 TGCCATATTTTTAAGAGAAAAGG - Intergenic
1052833757 9:33235382-33235404 CGCAACATTTTTTTGAGACAGGG + Intronic
1052936814 9:34100034-34100056 TCTCTCTTTTTTTAGAGACAGGG + Intronic
1053254527 9:36604648-36604670 TGACCCTTTTTTTTGAGACAGGG + Intronic
1054888130 9:70221321-70221343 TGCTTTTTTTTTTAGAGACAGGG - Intronic
1054935873 9:70686991-70687013 TTGTATGTTTTTTAGAGACAGGG + Intronic
1055923426 9:81485868-81485890 GGCCAAGTTTTGTAGAGACAGGG - Intergenic
1058893066 9:109377595-109377617 TGTCTCTCTTTTTAGAGACAGGG - Exonic
1059108338 9:111531188-111531210 TTCTATTTTTTTTAGAGACAGGG - Intronic
1059145294 9:111894831-111894853 TTCCACTTTTTTTTAAGACAGGG + Intergenic
1059234905 9:112752596-112752618 TTCAACATTTTTTGGAGACAGGG - Intronic
1059403221 9:114083703-114083725 GGCCACGTTCTTTAGACACTTGG + Intergenic
1060177033 9:121504735-121504757 TTTTACGTTTTTAAGAGACAGGG + Intergenic
1061408826 9:130407269-130407291 TGCCATGATTTCTAGAGAGAAGG - Intronic
1061437427 9:130574012-130574034 TGTTTTGTTTTTTAGAGACAGGG + Intergenic
1062019681 9:134312991-134313013 TAAAAGGTTTTTTAGAGACAGGG + Intergenic
1203743929 Un_GL000218v1:27605-27627 AGACACGTTTTTTAGTGTCATGG + Intergenic
1185849981 X:3476214-3476236 TTCTTCATTTTTTAGAGACAAGG - Intergenic
1185876055 X:3703277-3703299 TGTTTTGTTTTTTAGAGACAAGG - Intronic
1185881133 X:3741980-3742002 TGTGCTGTTTTTTAGAGACAGGG - Intergenic
1185881446 X:3744849-3744871 TTGTATGTTTTTTAGAGACAAGG - Intergenic
1185911550 X:3985671-3985693 TCCCAGTTTTTGTAGAGACAGGG + Intergenic
1185954233 X:4471498-4471520 TTCTTTGTTTTTTAGAGACAGGG - Intergenic
1185976304 X:4724654-4724676 TTTCTCGTTTTTTAGAGACAGGG + Intergenic
1186083850 X:5964677-5964699 TTTCACTTTTTGTAGAGACAGGG + Intronic
1186252258 X:7680976-7680998 TATTATGTTTTTTAGAGACAGGG + Intergenic
1186418138 X:9401141-9401163 TTTTACTTTTTTTAGAGACAGGG - Intergenic
1186443727 X:9607981-9608003 TTCCAATTTTTGTAGAGACAGGG + Intronic
1186846963 X:13540419-13540441 TCCCCCCTTTTTTAGAGACAAGG - Intergenic
1186886104 X:13915258-13915280 TTACACATTTTTTAGAGACGGGG - Intronic
1186889072 X:13942385-13942407 TGTTTTGTTTTTTAGAGACAGGG - Intergenic
1187064921 X:15824227-15824249 TACCCCTTTTTTTAGAGACAGGG + Intergenic
1187317887 X:18214244-18214266 TGGCATTTTTTTCAGAGACAGGG - Intronic
1187566338 X:20453263-20453285 TGCCACTTGTTTGATAGACAGGG + Intergenic
1187694023 X:21900066-21900088 TGCCACCTTTTTTTGAAACAGGG + Intergenic
1187884044 X:23872230-23872252 TTCCACTTTTTGTAGAGGCAGGG - Intronic
1188782760 X:34305941-34305963 TTTCACTTTTTGTAGAGACAGGG + Intergenic
1189072569 X:37879894-37879916 TGCATTGTTTTTTAAAGACATGG + Intronic
1189385827 X:40536168-40536190 CTCCACCTTTTTTTGAGACAGGG - Intergenic
1189791732 X:44611431-44611453 TCCCATTTTTTGTAGAGACAGGG - Intergenic
1189880701 X:45488409-45488431 TCCCAAGTTTAGTAGAGACAGGG - Intergenic
1190060449 X:47207976-47207998 TAACACCTGTTTTAGAGACAAGG + Intronic
1190073401 X:47297559-47297581 TGGTACTTTTTATAGAGACAGGG - Intergenic
1190175641 X:48146829-48146851 TTCTACTTTTTGTAGAGACAGGG + Intergenic
1191923916 X:66287953-66287975 TGCCTGGTTTTATAGAGTCAAGG + Intergenic
1192163314 X:68804887-68804909 TCCTACCTTTTTTTGAGACAGGG - Intergenic
1192355024 X:70394374-70394396 TTCTACTTTTTGTAGAGACAGGG + Intronic
1192412700 X:70948570-70948592 TTCCATTTTTTGTAGAGACAGGG + Intergenic
1193101422 X:77617889-77617911 TAAAACTTTTTTTAGAGACAGGG + Intronic
1195904175 X:109827880-109827902 TACTACTTTTTTTAGAGACAGGG + Intergenic
1196680783 X:118467410-118467432 TGCACTTTTTTTTAGAGACAGGG + Intergenic
1196756185 X:119159512-119159534 TGAAATGTTTTGTAGAGACAAGG + Intergenic
1197235218 X:124054772-124054794 TGTTTTGTTTTTTAGAGACAGGG + Intronic
1197336844 X:125219486-125219508 GGCTAAGTTTTGTAGAGACAGGG - Intergenic
1197823449 X:130564455-130564477 TAAAAAGTTTTTTAGAGACAGGG + Intergenic
1198077653 X:133210083-133210105 AGCTACGTTTTTTTGAGACAAGG + Intergenic
1199805985 X:151300910-151300932 TGACACTTTTTTTTGAGACAAGG - Intergenic
1200087419 X:153614472-153614494 TTGTACGTTTTGTAGAGACAGGG + Intergenic
1200765146 Y:7074808-7074830 TCTCATGTTTTGTAGAGACAGGG - Intronic
1201157252 Y:11142590-11142612 AGACACGTTTTTTAGTGTCATGG + Intergenic
1201290691 Y:12419564-12419586 TTTCAATTTTTTTAGAGACAAGG + Intergenic
1201889495 Y:18926531-18926553 TGCAATTTTTTTTTGAGACAGGG + Intergenic