ID: 1134247657

View in Genome Browser
Species Human (GRCh38)
Location 16:12552004-12552026
Sequence TTGCCACGTTTTTTAGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134247657_1134247664 7 Left 1134247657 16:12552004-12552026 CCTGTCTCTAAAAAACGTGGCAA No data
Right 1134247664 16:12552034-12552056 CTCAGATGGGAAGGATTTTTGGG No data
1134247657_1134247661 -2 Left 1134247657 16:12552004-12552026 CCTGTCTCTAAAAAACGTGGCAA No data
Right 1134247661 16:12552025-12552047 AAGTCCAGGCTCAGATGGGAAGG No data
1134247657_1134247659 -7 Left 1134247657 16:12552004-12552026 CCTGTCTCTAAAAAACGTGGCAA No data
Right 1134247659 16:12552020-12552042 GTGGCAAGTCCAGGCTCAGATGG 0: 1
1: 0
2: 1
3: 22
4: 204
1134247657_1134247663 6 Left 1134247657 16:12552004-12552026 CCTGTCTCTAAAAAACGTGGCAA No data
Right 1134247663 16:12552033-12552055 GCTCAGATGGGAAGGATTTTTGG No data
1134247657_1134247660 -6 Left 1134247657 16:12552004-12552026 CCTGTCTCTAAAAAACGTGGCAA No data
Right 1134247660 16:12552021-12552043 TGGCAAGTCCAGGCTCAGATGGG No data
1134247657_1134247665 8 Left 1134247657 16:12552004-12552026 CCTGTCTCTAAAAAACGTGGCAA No data
Right 1134247665 16:12552035-12552057 TCAGATGGGAAGGATTTTTGGGG 0: 1
1: 0
2: 2
3: 20
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134247657 Original CRISPR TTGCCACGTTTTTTAGAGAC AGG (reversed) Intronic
No off target data available for this crispr