ID: 1134247658

View in Genome Browser
Species Human (GRCh38)
Location 16:12552011-12552033
Sequence CTAAAAAACGTGGCAAGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134247652_1134247658 10 Left 1134247652 16:12551978-12552000 CCATGTCAAAGTAGCTCCTGCTG No data
Right 1134247658 16:12552011-12552033 CTAAAAAACGTGGCAAGTCCAGG No data
1134247650_1134247658 22 Left 1134247650 16:12551966-12551988 CCCAACACAGTGCCATGTCAAAG No data
Right 1134247658 16:12552011-12552033 CTAAAAAACGTGGCAAGTCCAGG No data
1134247651_1134247658 21 Left 1134247651 16:12551967-12551989 CCAACACAGTGCCATGTCAAAGT No data
Right 1134247658 16:12552011-12552033 CTAAAAAACGTGGCAAGTCCAGG No data
1134247654_1134247658 -6 Left 1134247654 16:12551994-12552016 CCTGCTGGTCCCTGTCTCTAAAA No data
Right 1134247658 16:12552011-12552033 CTAAAAAACGTGGCAAGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134247658 Original CRISPR CTAAAAAACGTGGCAAGTCC AGG Intronic
No off target data available for this crispr