ID: 1134247659

View in Genome Browser
Species Human (GRCh38)
Location 16:12552020-12552042
Sequence GTGGCAAGTCCAGGCTCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 204}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134247654_1134247659 3 Left 1134247654 16:12551994-12552016 CCTGCTGGTCCCTGTCTCTAAAA No data
Right 1134247659 16:12552020-12552042 GTGGCAAGTCCAGGCTCAGATGG 0: 1
1: 0
2: 1
3: 22
4: 204
1134247651_1134247659 30 Left 1134247651 16:12551967-12551989 CCAACACAGTGCCATGTCAAAGT No data
Right 1134247659 16:12552020-12552042 GTGGCAAGTCCAGGCTCAGATGG 0: 1
1: 0
2: 1
3: 22
4: 204
1134247657_1134247659 -7 Left 1134247657 16:12552004-12552026 CCTGTCTCTAAAAAACGTGGCAA No data
Right 1134247659 16:12552020-12552042 GTGGCAAGTCCAGGCTCAGATGG 0: 1
1: 0
2: 1
3: 22
4: 204
1134247656_1134247659 -6 Left 1134247656 16:12552003-12552025 CCCTGTCTCTAAAAAACGTGGCA 0: 1
1: 1
2: 5
3: 68
4: 785
Right 1134247659 16:12552020-12552042 GTGGCAAGTCCAGGCTCAGATGG 0: 1
1: 0
2: 1
3: 22
4: 204
1134247652_1134247659 19 Left 1134247652 16:12551978-12552000 CCATGTCAAAGTAGCTCCTGCTG No data
Right 1134247659 16:12552020-12552042 GTGGCAAGTCCAGGCTCAGATGG 0: 1
1: 0
2: 1
3: 22
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134247659 Original CRISPR GTGGCAAGTCCAGGCTCAGA TGG Intronic
900205913 1:1431857-1431879 TTGGCAAGCACAGCCTCAGACGG + Intergenic
900838965 1:5032003-5032025 TTGGCAACTCCAGGCTCATTGGG + Intergenic
900849301 1:5129869-5129891 CTGGCAAGTGCAGTGTCAGAGGG + Intergenic
902240312 1:15083976-15083998 ATGGGAAGTGAAGGCTCAGAGGG - Intronic
902882610 1:19382700-19382722 GTGGCTAGGCCAGGCTCTGCGGG - Intronic
903754162 1:25649226-25649248 GTGGCAAGTGCAGGCTGAATAGG + Intronic
904920578 1:34004868-34004890 TTGGCAAGTCCAGAGCCAGATGG - Intronic
905261267 1:36721099-36721121 GTGGCAATGCCTGGCCCAGAGGG + Intergenic
906274236 1:44504422-44504444 GGGGCCAGTCAAGGCTCAGAAGG - Intronic
909312567 1:74171744-74171766 GAGAAAAGTCCAGGGTCAGATGG - Intronic
909494793 1:76266696-76266718 GTGGCAAGTGGAAGCTTAGATGG - Intronic
910348113 1:86264133-86264155 GTGGCAATTCCATGCTCGCAAGG - Intergenic
911124790 1:94331044-94331066 TTGGAAATTCCAGCCTCAGAAGG - Intergenic
911125273 1:94335436-94335458 AAGGTAAGTTCAGGCTCAGAAGG + Intergenic
911963825 1:104340353-104340375 GTGGCTAGTCAAAGATCAGATGG + Intergenic
917789221 1:178488654-178488676 GTGGCCACCCCAGGCTCTGATGG + Intergenic
917872366 1:179253491-179253513 GTAGCAACTCCAGCCTCAGCTGG - Intergenic
919855805 1:201705273-201705295 CTGGCAGTTCCAGGCTGAGATGG + Intronic
923147539 1:231208711-231208733 TTGGCAAGGCCAGGCTCGTAGGG + Intronic
923799579 1:237194464-237194486 GTGGCAAGTCCAGGAGAACAAGG + Intronic
924511614 1:244732691-244732713 GTGGAAGGGCCAGGCCCAGATGG - Intergenic
1063892286 10:10642889-10642911 GTGGCAACACCGGGGTCAGATGG - Intergenic
1063951190 10:11224905-11224927 GAGCCAAGGCCAGGATCAGAGGG + Intronic
1065223638 10:23521192-23521214 GTGCCATCTCCAGGCCCAGAAGG + Intergenic
1065388497 10:25157762-25157784 CTGCCCAGCCCAGGCTCAGAGGG + Intergenic
1067755159 10:48999780-48999802 GTGCCAAGTCCAAGCTGAGAGGG + Intergenic
1071551563 10:86570072-86570094 GTGGAAAGCTCAGGGTCAGATGG + Intergenic
1071899950 10:90109516-90109538 GGATCAAGTCCAGGCTCACATGG + Intergenic
1072168955 10:92841978-92842000 CTGGAAAGTCCATGCTCACAGGG + Intronic
1072172540 10:92879867-92879889 CTGGCAATTCCAGGCTCCTATGG - Intronic
1073039671 10:100594617-100594639 GTGAAAAATCCAGTCTCAGAAGG + Intergenic
1073571102 10:104581742-104581764 GTGGGAGGACCAGGCTCAGAAGG + Intergenic
1074197188 10:111199839-111199861 GGGCCAAGGCCATGCTCAGAGGG - Intergenic
1074733139 10:116398655-116398677 TTGGCCAGGCCAGGCTCAGGGGG + Intergenic
1075429288 10:122366886-122366908 GTGAGGAGTCCAGGCACAGATGG + Intergenic
1075920882 10:126211672-126211694 TTGGCAGGTCCAGGATCACATGG - Intronic
1076619514 10:131778332-131778354 GTGGCAAGTCCAGGGTGGGCAGG + Intergenic
1076682570 10:132181405-132181427 GTGACACTTCCAGGCTGAGAAGG - Intronic
1078826715 11:14936875-14936897 GAAGCAGGTCCAGGCTCAGCAGG - Intronic
1079113069 11:17617425-17617447 GAGAAAAATCCAGGCTCAGATGG - Intronic
1079301189 11:19280394-19280416 GAGACAGGTCCGGGCTCAGATGG + Intergenic
1083948658 11:65941343-65941365 TTGGCAGGTGCAGGCTCACAGGG + Intergenic
1083962126 11:66020468-66020490 GTGGCATGACCAGGGTGAGAGGG + Intronic
1083968006 11:66054710-66054732 GAGGCAAATCCTGGATCAGAAGG - Intronic
1084063859 11:66692412-66692434 GGGGCAAGACCAGGCTGAGCAGG - Intronic
1084659780 11:70539984-70540006 GTGGGAAGGCCAGGCGAAGATGG - Intronic
1084881330 11:72173481-72173503 GTGGCATGGACAGGCTCCGAGGG + Intergenic
1084956679 11:72695320-72695342 GGGCCAGGTACAGGCTCAGATGG - Intronic
1086387402 11:86323555-86323577 GTGGCAAGAACAGGCAAAGATGG - Intronic
1088860364 11:113793182-113793204 ATGACAATTCCAGGCTCAGATGG + Intergenic
1089191427 11:116656265-116656287 GTGGGAGGCCCAGGCTCAGCTGG - Intergenic
1089736257 11:120552136-120552158 GTTGCAAGTCCAGGCCCCGGGGG - Intronic
1090617808 11:128532179-128532201 GTGGCAAGTCCAAGCTTGCAGGG - Intronic
1091832636 12:3560826-3560848 GGGGCAAATAGAGGCTCAGAAGG - Intronic
1092567968 12:9688284-9688306 GTGGCAGGAACAGGCCCAGAGGG + Intronic
1096342556 12:50814039-50814061 TTGGCAAGTCCAGGCACAGATGG + Exonic
1096673220 12:53212263-53212285 TTGGACAGTCCAGGCTTAGAAGG - Intronic
1097187652 12:57204322-57204344 GTGGGGGTTCCAGGCTCAGAGGG - Intronic
1098886336 12:75964407-75964429 GAGGCAAGGCCAGCCTGAGAAGG - Intergenic
1100234058 12:92639892-92639914 TTGGAAAGTCCAGGATCAAAGGG - Intergenic
1101360164 12:104018926-104018948 GAGGCAAATCCAGGTTCTGATGG + Intronic
1102490550 12:113287587-113287609 GAGGCAAGCCCAGGCTCTGAGGG - Intronic
1102959232 12:117081189-117081211 GTGGTAAGCCCAGACTGAGATGG + Intronic
1104657117 12:130581571-130581593 GTGGCAATTCCAGGCTCTCGCGG + Intronic
1106478261 13:30116400-30116422 GTGGGAAACCCAGGCCCAGAGGG - Intergenic
1108229707 13:48323138-48323160 GAGAAAAGTCCAGGCCCAGATGG - Intronic
1112227881 13:97558273-97558295 GTGACATCTGCAGGCTCAGAAGG + Intergenic
1112969554 13:105243536-105243558 GTGGGAAGGCCAGGCCCACAGGG - Intergenic
1113462347 13:110491047-110491069 CTGGCTAGTGCAGGCTCAGAGGG + Intronic
1115715871 14:36102619-36102641 GTGGCATGTCAAGTCACAGAGGG - Intergenic
1117954757 14:61113891-61113913 GCAGCAGGTGCAGGCTCAGAAGG - Intergenic
1118846768 14:69553369-69553391 GTGGCAACTCCTGGCTGAAAGGG - Intergenic
1121212840 14:92221836-92221858 GTGGCAAGAGCAGGGGCAGAAGG + Intergenic
1121784822 14:96649558-96649580 GTGGCAACTGCAGGCTGGGAGGG + Intergenic
1124153687 15:27207159-27207181 GTTGCTAGTCCAAGATCAGAAGG - Intronic
1125422820 15:39521556-39521578 GAGGCAAGTGAAGGCACAGATGG + Intergenic
1126230636 15:46319391-46319413 GAGCCAAGCTCAGGCTCAGAAGG + Intergenic
1127197655 15:56606993-56607015 AAGGTAAGTCCAGGGTCAGATGG - Intergenic
1127975400 15:63993280-63993302 GTGGCAAGTTTAGGCACACATGG + Intronic
1129107556 15:73320062-73320084 GTGGTTAGGCCAGGCTCTGATGG + Exonic
1130047213 15:80454602-80454624 CTGGCCAGTCCAGGCTCTGAAGG + Intronic
1130813380 15:87405562-87405584 GTGCCAGGACCAGGCTCAGAAGG + Intergenic
1133970189 16:10561945-10561967 GAGGAAACTCCAGGCCCAGATGG + Intronic
1134125637 16:11614070-11614092 GAGGCTTGTGCAGGCTCAGAAGG + Intronic
1134247659 16:12552020-12552042 GTGGCAAGTCCAGGCTCAGATGG + Intronic
1137508780 16:49080028-49080050 GTGTCAAGTCCAGGCACATAAGG + Intergenic
1138060040 16:53880562-53880584 GTAGCAAGTTCAAGATCAGATGG + Intronic
1139334415 16:66221202-66221224 GTGGCAGGTGCAGGCTGAGGTGG - Intergenic
1139528546 16:67530451-67530473 GAGACAAGGACAGGCTCAGAAGG + Intronic
1140037824 16:71384416-71384438 GGTGCAGGGCCAGGCTCAGAGGG - Intronic
1140590940 16:76352071-76352093 GTGGAATTTCCAGGCTGAGAGGG + Intronic
1140850522 16:78930945-78930967 GTGACATGTCCAGGTTCATAAGG - Intronic
1142341961 16:89529439-89529461 GAGGCAGGCACAGGCTCAGACGG - Intronic
1142584975 17:966748-966770 GTGGTCTGTCCAGGCACAGAGGG - Intronic
1143300002 17:5902118-5902140 GAGGCAAGACGATGCTCAGAAGG - Intronic
1144673552 17:17146608-17146630 CTGGCAGGTCCAGCCTCAGATGG - Intronic
1145001238 17:19306200-19306222 GAGCCAAGGCCAGGCTCAGGTGG + Intronic
1146021068 17:29279644-29279666 GTGGCATGTGGAGGCTGAGATGG - Intronic
1146902870 17:36599773-36599795 GTGGCTTCACCAGGCTCAGAGGG - Intronic
1147185439 17:38710955-38710977 GTGGCAGCTCCAGGCTTATAAGG + Intronic
1147782517 17:42953851-42953873 GCAGCAAGGCCAGCCTCAGAAGG - Intronic
1148491563 17:48026785-48026807 GTGCCACGTCCAGGCGGAGACGG + Intronic
1148953796 17:51336901-51336923 GAGGCAAGTTCAGCATCAGAAGG + Intergenic
1150325810 17:64256442-64256464 ATGGGAAGGGCAGGCTCAGAAGG - Intronic
1151191960 17:72405197-72405219 GTGGAAAGCCGAGGCACAGAGGG + Intergenic
1151410582 17:73924888-73924910 GCTGGAAGTCCAGGATCAGAGGG - Intergenic
1154989494 18:21587377-21587399 ATGAAAAGCCCAGGCTCAGATGG - Intronic
1157862236 18:51151830-51151852 CTCGCAGGTCCAGTCTCAGAGGG + Intergenic
1157953341 18:52064872-52064894 GTGGCCAGTGGAGGCCCAGAGGG + Intergenic
1160100122 18:75912678-75912700 TGGGCAAGTCCAGGATCAGCAGG - Intergenic
1161608139 19:5225995-5226017 GTGGCATGGCCATGCTCAGAGGG + Intronic
1163950374 19:20579087-20579109 ATTTCAAGTTCAGGCTCAGATGG - Intronic
1166888465 19:45975294-45975316 GAGGCAAGATTAGGCTCAGAAGG + Intergenic
1166966075 19:46530062-46530084 GTGGCAGGGCCAGGCACAGAGGG - Intronic
1167368151 19:49065302-49065324 GTCGCAAGTCCTGGGTCTGAGGG - Intergenic
1167393319 19:49211006-49211028 GTGCCAAGTCCACCCTGAGAAGG - Exonic
1167580875 19:50341791-50341813 TTGCCAAGCCCAGACTCAGAGGG + Intronic
1167708386 19:51095285-51095307 GCCGCAAGCCCAGGCTAAGAGGG + Intergenic
1168394908 19:56039443-56039465 GTGAGACATCCAGGCTCAGAGGG + Intronic
926845392 2:17131653-17131675 AAGGAAACTCCAGGCTCAGACGG + Intergenic
928706385 2:33954142-33954164 GTGGCACCACCAGGCTCTGAGGG + Intergenic
929295344 2:40240260-40240282 GTGCCAAGTCAAGTCTCCGACGG + Intronic
929575442 2:43049114-43049136 AAGCCAAGTCCAGGATCAGAGGG - Intergenic
929877477 2:45808746-45808768 TTGGTTAGTCCAGTCTCAGATGG + Intronic
932419087 2:71590891-71590913 GGGGCAAGGCCAGTGTCAGATGG - Intronic
933784210 2:85825751-85825773 GTGCCAAATCCAGGGTCATAAGG + Intergenic
935203950 2:100881794-100881816 GGAGGAAGTCCAGGCGCAGAGGG + Intronic
940728468 2:157362169-157362191 GTGGCTTTTCCAGGCACAGAGGG - Intergenic
943040656 2:182800900-182800922 GTGTCATGTCCATGCTCAAAAGG + Intergenic
946215972 2:218183930-218183952 ATGGAAACTCCAGGCTCAGCTGG - Intergenic
947587255 2:231364186-231364208 GTGGCAGGGCCATGCTGAGAAGG - Intronic
947867867 2:233413820-233413842 TTGGCAAGCCCTGACTCAGAGGG - Intronic
1169856205 20:10106133-10106155 TTGGCAACTCTTGGCTCAGATGG - Intergenic
1170447896 20:16448528-16448550 GTGGCCTGTCCAGGCCCAGGAGG - Intronic
1171153035 20:22844544-22844566 GTGGCAAGCACAGCCTGAGATGG + Intergenic
1172442532 20:34976346-34976368 GAGGCCAGACCAGGCTCACACGG - Intronic
1172446625 20:34996787-34996809 GGGCCAGGTGCAGGCTCAGAAGG - Intronic
1172631078 20:36378668-36378690 AGGGCAACTCCAGACTCAGATGG - Intronic
1174451740 20:50624836-50624858 GTTGCAAGTGCAGGCTCTGGAGG + Intronic
1174476360 20:50798649-50798671 GTGCCCAGTCCAAGCTGAGATGG - Intronic
1179727489 21:43348501-43348523 GTGGCCAGGCCGGGCCCAGAAGG + Intergenic
1180173383 21:46073588-46073610 ATGGAAACTCCAGGCCCAGATGG + Intergenic
1183106747 22:35620453-35620475 GTGCCAGGCCCAGCCTCAGAAGG + Intronic
1183351046 22:37334933-37334955 ATGGCAGGTCCTAGCTCAGAGGG + Intergenic
1184689355 22:46110418-46110440 GTGGCCAGTCCAGCCTGAGGGGG + Intronic
1185225268 22:49648411-49648433 GTGGCCATGCCTGGCTCAGAAGG - Intronic
949805852 3:7954681-7954703 GTGACAAGTCCAGATTCAGTGGG - Intergenic
951966331 3:28389761-28389783 TTGGCAAGTCCAGTTTCTGATGG + Intronic
954928628 3:54260366-54260388 CTGGGAAGTCCAGGGTCAAAGGG + Intronic
955477531 3:59353554-59353576 GTGGAAAGTTCAGGCTCACATGG - Intergenic
959027150 3:101253067-101253089 GTGGCAAGTGGAGGTTTAGAGGG + Intronic
960403180 3:117228889-117228911 CTGGCCAGGGCAGGCTCAGATGG - Intergenic
960628306 3:119702905-119702927 GTGGCCAGGCCAGGGTCAGGAGG - Intergenic
961469308 3:127101327-127101349 TGGGCCAGTCCAGGCTGAGAAGG + Intergenic
961473663 3:127134148-127134170 GTGGCCTGTCCAGCCTCACAGGG + Intergenic
961569189 3:127786013-127786035 GTGCCTACTCCAGGCGCAGAAGG + Intronic
968642841 4:1722895-1722917 GGGACAAGACCAGGCTGAGAGGG - Intronic
968708607 4:2095951-2095973 GTGTGAAGTTCAGGCACAGAAGG + Intronic
968794656 4:2694658-2694680 GTGGCAGGGGCAGTCTCAGAAGG + Intronic
968917677 4:3503957-3503979 GTGGCCAGTCCAGGCTTACGGGG + Intergenic
969107889 4:4821702-4821724 GAGTGAAGTCCAGGCTGAGATGG + Intergenic
969395589 4:6918578-6918600 GAGGGAAGTTGAGGCTCAGAAGG + Intronic
969702933 4:8777626-8777648 GGGGCAAGTCCATTTTCAGAGGG + Intergenic
971484537 4:27145946-27145968 GAGGCTGGTCCAGGCTCAGTGGG - Intergenic
972311398 4:37886957-37886979 AAGGCAAGTCCATGCTCAGTGGG - Intergenic
975132272 4:70841429-70841451 TTGACAAGTCCTGGCTCAGGAGG - Intergenic
978556025 4:109981419-109981441 GTGGGAAATCCAGCCTGAGAAGG + Intronic
979849463 4:125558197-125558219 CTGGGAAGTCCAAGCTCAAAGGG + Intergenic
980179308 4:129384811-129384833 CTGGCTTGTCCAGGCTCTGAGGG + Intergenic
980603034 4:135050551-135050573 TTGCCAAGTCCAGACACAGACGG - Intergenic
981355414 4:143784245-143784267 GAGGGAAGTCCAGGCTGACAAGG + Intergenic
988798225 5:34672638-34672660 GTGGCAAATCCAGGCTGGCATGG + Intronic
989218381 5:38928040-38928062 GGTGGAAGTCCAGGCTCAGATGG - Intronic
990013841 5:51033478-51033500 GTGGCAGGTGCAGCCTCAGTTGG - Intergenic
991537034 5:67680794-67680816 ATTGCAAGTCCAGGTTTAGAAGG - Intergenic
993476607 5:88374011-88374033 CTGGGAAGTCCAGGATCAAAGGG - Intergenic
997294130 5:132759439-132759461 GTGGCCAGTTCAGGGTCTGAGGG - Intronic
999582136 5:153050627-153050649 ATGGCAGGTGCAGGCTCACAAGG - Intergenic
999955351 5:156695413-156695435 CTGGCAAGTCCAAACTCAGCAGG - Intronic
1002593395 5:180306370-180306392 GTGGCCAGTGCAGCCTCAGCTGG + Intronic
1003349596 6:5303537-5303559 GTGGGGAGGGCAGGCTCAGAGGG - Intronic
1005592624 6:27344426-27344448 GGGGCAGGTACATGCTCAGAAGG - Intergenic
1011706215 6:90003866-90003888 GTGGCATGACCAGGATGAGAAGG - Intronic
1014046334 6:116892458-116892480 GTCCCAAGTCCATCCTCAGAAGG + Intronic
1016078272 6:139824005-139824027 GTGGCAAGTCCAAGGTCCCAGGG - Intergenic
1016299019 6:142609081-142609103 GTGGCTAGTCCAAGCTGAGATGG - Intergenic
1018502859 6:164430906-164430928 ATGGCAAGTCCAAGATCAGAGGG - Intergenic
1019485163 7:1285929-1285951 GGGGCAGGGCCAGGCTCAGCGGG - Intergenic
1019542132 7:1556224-1556246 GCGGCAAGGCCAGGATCTGAAGG + Exonic
1019600996 7:1883719-1883741 GGTGCAGGTCCAGGCTCAGAGGG + Intronic
1019924678 7:4184348-4184370 GTCTCAAGGCCAGACTCAGAGGG - Intronic
1020082752 7:5295611-5295633 CGGGCCAGTCCAGGCACAGAAGG - Intronic
1022472256 7:30689092-30689114 GGGGCCAGCCCAGGCTCAGCAGG - Intronic
1022708453 7:32829406-32829428 ATGGCAAGTCAAGGCCCAGATGG - Intergenic
1022914721 7:34936071-34936093 ATGGCAAGTCAAGGTCCAGATGG + Intronic
1023228982 7:38004468-38004490 CTGGCAAGTCAAGGCTAAGTTGG + Intronic
1025211517 7:57021566-57021588 CGGGCAGGTCCAGGCACAGAAGG + Intergenic
1025660438 7:63555281-63555303 CGGGCAGGTCCAGGCACAGAAGG - Intergenic
1025705388 7:63858063-63858085 GTGGCAAGTGGAGACACAGAGGG + Intergenic
1026215229 7:68342614-68342636 GCAGCAACTCCAGCCTCAGAAGG - Intergenic
1026893575 7:73997308-73997330 ACGCCAAGTCCTGGCTCAGAGGG + Intergenic
1030786446 7:113669401-113669423 AAGGAAAGTCCAGGCTCAGATGG + Intergenic
1031486205 7:122329080-122329102 GTGGCAACTCCTGGCACTGAGGG - Intronic
1032068381 7:128789766-128789788 GGGGGAAGTCCAGGCAAAGAAGG + Intergenic
1032453082 7:132051505-132051527 GGGGCAGGTCCAGGCCCAGATGG + Intergenic
1033552637 7:142461906-142461928 CTGGGAAGTCCAGGATCAAAGGG - Intergenic
1035774344 8:2176223-2176245 GTGGCAGGTCCTGACTCAGTGGG - Intergenic
1040345073 8:46484676-46484698 GTGGCAGCTCTAGGCTCAGACGG + Intergenic
1041158333 8:55010932-55010954 GTGGTGAGTCCAGGTTCAGCTGG + Intergenic
1043973528 8:86559978-86560000 TTGCCAAGGCCAGGCTGAGAGGG + Exonic
1044066214 8:87703372-87703394 ATGGCACGTCCTGGGTCAGAAGG + Intergenic
1044317706 8:90769017-90769039 GTGGCAAGTCCATGCTTGTAGGG + Intronic
1048704299 8:137133991-137134013 GGAGCCAGTCCAGGCTCTGAGGG + Intergenic
1049773734 8:144395383-144395405 GTGGCCCGGCCAGGCCCAGAAGG + Intronic
1051189322 9:14494482-14494504 GAAGCCAGTCCAGGCTAAGAAGG - Intergenic
1051400023 9:16671011-16671033 GTGGGAAGTTCATGCTCAGACGG + Intronic
1051481772 9:17569424-17569446 GTAGCAAGGCCAGCCTTAGAGGG + Intergenic
1054741672 9:68812024-68812046 ATGGCAAAGCCAGGCTGAGATGG + Intronic
1057567826 9:96180628-96180650 CTGGCAAGTGCAGGCCCAGCAGG + Intergenic
1058374993 9:104312571-104312593 GTGACGATCCCAGGCTCAGAAGG + Intergenic
1060007824 9:120015933-120015955 TGAGCAAGTCCAAGCTCAGACGG + Intergenic
1187206624 X:17187649-17187671 GTGGCTAGTCCAAGGTCACATGG + Intergenic
1187438166 X:19291555-19291577 GGGGCAATTCCAGGCTCATTGGG - Intergenic
1187604045 X:20863665-20863687 AAGACAAGTCCAGGCTCAAAGGG - Intergenic
1193423247 X:81309469-81309491 TAGGGAAGTCCAGGTTCAGATGG - Intergenic
1196738252 X:118999825-118999847 ATGGCTACTCCAGGCACAGAGGG - Intronic
1198427169 X:136531780-136531802 GTGACAAGTCCAGACTCCTAGGG + Intergenic
1201734606 Y:17244797-17244819 GTGCCCAGCCCAGGCTGAGAAGG - Intergenic